Description :
From Genome Similarity Track
Location :
Scaffold_3828:110- 2773
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3828-snap-gene-0.133 kDa chaperonin
Pytar_ATCC12531maker-par_contig_3828-snap-gene-0.2Vacuolar protein sorting-associating protein

Sequence
2663 bases(100 bases per row)
GAGTAGTTGGTTACTGATGTATTGTGTGTGTAGGCTACATGGAAGTCTCGAAGATTCTGTATGGCGAAACCAAGCCATACGTCACGACAGTGCCCGCAAC
CGGACATGCTGAGCGTGATTGGCAGACGTTCTACGACGTCTCGGAGCAAGTCCCCACGGTTGTTCGCGTCGGCCAGGCTACCGAGTCGGATGAGCTGCGG
TGCTGTGGTCTCACGATTCAGAAGATGCCAGACTCGGCACCCCACGATCGCCGATATGATCTCACCGATCTTCGCTTTGATTCTGCAAGCTTCTCACCTC
CAAGTCTAGCTGACAAAGATGATCTCCTCGAGTACCTAAACGAGCTCATCCCCAACGCCGACCTGAAGGAAGACAAATGCCGCAGAATTCCGCTCGACTT
TTACTGTCGGTGTTCGAAGAAAGGATTCAGTGAGCGGCTCGCGGGGCTCGGCGAGGAACAACTCGACAGCATCATTTCAGACACGGGGGAAAAAGGTATC
GAACTGACATGCCATTTCTGCAATGAACTGTACCGATTTTCGCTTGGTGATCTCAAAGCGATCGTCCCCACGAGTCCATCCAGTAATCTTTAAAGGGCCT
CAAATAGACACCTCTGGGGGATTGTTTGCCGTCTCAGCCCTCTTGGCCAAACTCCTGGGTCCACTTGACAAAGCGATTGAGTTCATCTGAAGCAACACTT
GAGACCGAGTGCTCCAGAACGCGCTTGAAGTCGTTCTACAGTAGACAACCGTCAACCCAGTTATAAATTGCTCATCAGGCGAAATAGTCAATGCAAAGAC
TAGGGAGAGGATGTACCATGGACACCATTGGTGGCCGAAGTTTGTCGTCAGAGAACCCACGGCTGGGCAGGTCGTACAGGCGCATCCGAAAAGCTCCGCA
TCGACGGCACGGCGCCTTGCACTCGGCGCACTGTCGTGGACAAGACGAGAGTTTCATGTGGCAATACGCACACGGCGGATCGTCGTCGCACGGGGTCAGG
AATTCGCCATTCGGATGCGGCACAGCCTTTTCGTTACACTGGGTGGTGAAAGCAAGGATGGTTAGATCAACCAATCGTTGACATCATGCAAGGGAGTTCA
CGTACACGAGTGAAAAACTGGGCCTGCTGGCACTTGCGCAATGGCTCCATCAGTGCTTCTCGCACAAGCACGGAAATATCGGAGCCCGAACATCTACGTG
TCTTCGAATGAGAACCAGAAAACCGCGACACCAAGTACCAATATTCACTCACCCATCAGTGTTCTTGGCTATTCCGTAAAAATCTTGATCCGTCAACGCG
TGCGGAGTGTCGCCCAAGTGAAGCATCAGCATCGCCTGGCGCGCCTCCAATTCAGGGAGCGGAATATAGATTCGCTTCTCGAATCTGGACAACATACATG
GCTTAGGTCAACGCGGCAAATCTCATACTGGGCACGGGAATGTACGAACCGTCGACGCATGGCGGGGTCCAGCTCCCACGGCACGTTCGTCGCTCCGAGC
ACCAGAATCCCGTCATGGTTGTTTCCAACACCTTGCATTTGGACAAGGAACTCGGTTTTGATGCGTCGGGTGGAGTCACTCTCGCCTTCTGTGCGGTTGG
AACAGAGCGAGTCGATCTCATCAATGAAAATGATGGCGGGCTTCTTCTCTCGAGCCATCTCGAACAGATTCTTGACAAGTCTGTTTGTTCACAGATACTC
GTCGGTCAGAGGACACACGGCACCAAAGAAAACAATTCCGCCGATTCACTTTTCGCTTTCACCCTGCCACTTGGACACGAGACTCGACGATGACACGGCG
AAAAACGTCGAGTCTGCTTCAGTCGCGACCGCCTTAGCCAGATACGATTTACCTGTGCCTGGTGGCTACACAACGAACGGCTTAGACCAGGATTCTGGCA
CTATATGTGATGAAGAGAGAGGCGACCGAACCCCGTAGAGGAGAATCCCTTTCCAAGGACGCCGCTTGCCTGTGAAAAGTTGCGGGAAACGCGCGGGCAA
GATCACGGCTTCTTTCAACGCATCCTTGGCAGCATCCAGGCCAGCTACGTCGTCCCACATGACGTTTGGCTTCTCAGAGATGACCGCCGCTGCATCCACG
ACGCACACGTTAGTTCAAGCGCTGGCGTTGTATCAGTACCTTACATCGTACTTACAGGCTAAAGACCCACGCAGTTTGGCAGTCTCAGCATCCGTTTCGT
CCTCCCCATCGCTCTTGTCGCCTCTACAGGAAACGCGGCTCACAAATGTCAATAGCAGCATGGAAGCCGAGCGCTCAAACGCATTGCAATATACTTTTCC
AGCTCAGCCGCGCCGGACGATGCAATCACTTTCGGGCCGTTGCCTTTCTCGAGCATCGTGCGCAATTGCTCCGCGCGCGTCATGTATCCTTCCACACGCT
TCATGATGATCTCCTTGGACGTCGGATTCTTCTCATCTGAAGATGAAATCCCCCATCGGACATCGCGTCAGTCAAAGCCCCACTCATATACACACCCGCT
GTTCCCCTTGACGTACACTTGACGCCGACCATAAAGTGCTCGAGCGCTTTCTTGTAGAGCCCAAAGGCCTCCTCGTAGTTCTTCTTGTTGTCCTCATTGA
TCGCGAGCGTGACGATCTCGATCGCCTGCGGGATGAACTTGTTCTCCATCGGATCCCGTCCTC