Description :
From Genome Similarity Track
Location :
Scaffold_3009:110- 1558
Transcript NameFunction/comments
Phyag_g12969hypothetical protein PHYSODRAFT_368429

Sequence
1448 bases(100 bases per row)
CTGTTTGAACAATTAAGACAGGATCAGTAGATGGGTGACACCGGAGGAGTTATCCGGTGCCAACAAGTAAGCCAATGCAATACAACTCAATTTTCTTCTC
AAGTCTCAAGGCCTCCTTCAACAGGTTGCGAGCCCAAGGTAAGCCttccatgacgacgaccacgagGTTCCGCGCCTCAACGGCCGGAACTTCATCATCT
GGAAGACACGCGTCACCGCTGCGCTCGAAGGCAAGAACCTACTCGGCTTCGTCGCTCGCCCGGACTACACTGGTGACTCTGACCCAgacttcagcgacga
cgacgaactcgaccCCGCGCTCTTCGATCAGAACCAAGCGGTGAAAAATACCCTCGACGAGATTGGTGCGCCTAACGCAGACCCTCCGGCTGACACCTCA
CCGAGCGCAACCTCGGATGcaagctccaccgcctcaGACACTGACGGAAACGTCGAGATGACGCAGGAGAATCTCCCTGCGGTCATGACGTTCACTGCCA
CGAAGCAGGACGAACGCAAGCAGgctgagaagctgaaggccaAGAGCCCAACGCTGAGATCAAGACAGCTACGCCACATGGAGGCGAAAATAAAGGCCTT
GTTGATCAAGGCCATTGATGACAATCATGTTCTCAAGGTCAAGGACACGACCAATGCGAACGAGATCTACAAGACTCTGTACAATGTACGAAGATGCCGC
CATTCATAGTGATCCATACTACATCTTGAACTGCCTGATGGCTCTGAAGTATGACGAAAACTCGGATCTCAACAAGTTCCTGTACGACCTCGAAGAAGCC
ATGAAGGCCGCCTCAGACGCTACAAACAGCGTGATGGGAGATGAGCAAAAGACCATCTACCTGTACCATTCAGTGCCGGGGGTCTGGGAGGCTGAAATGG
CAGCGTAGAAGGGCAGTCGTAAGTACGTCCCGTATgaggagctcaagcaccACATCGAGACCAAAGTCCGCACCGAGATGGCGCGCAATCGCATATTCTC
AAACAAGGCACGCCGGAATCGTGCGAAACCCGATCCGAGAAGGTACTACAAACTGCGGACCCTACGCCCACGCCAGAACCAGCAAAGGAGGCTACGGCAC
TCGTGTCAACCCCTAGCTGTACGTACTGCCTCCGAAACAACCACGACATGGTCAACTGTTATATACtacagcgccacctcctAAATGGCCAAGTAAAAGC
CGGTACAGTCATTCCCGCCAATTTCAAGGTGAATGTGGATCATGACTCACAACGCCAGCACCCTGACAAGCACGAAAACAAGGGTGACCGTAACAATAAC
CACCgcaacaactacaacaaACGCGGAAACAATTCCCGGAACTCCAACGGCAGACGCCAAGACCGTAGCGGACGCAATGACCACCAAGGCCGCAATTACT
GCAACAAATTCCTAGGATGTCGCAACCAAGGCGGGGGTAACTGTAATG