Description :
From Genome Similarity Track
Location :
Scaffold_203:110- 1351
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_15871serine/threonine protein kinase

Sequence
1241 bases(100 bases per row)
CGCCTCGTCCGCCGAGAGATAGCAGTAGAGCGCGCAGCCGTGCAGCACAAAGTAGTAGGCTTCCCACTGCTTGAGCCAGTCGGACCGCTTCTGGAGGTAG
CCCTCCCAGCGCGTCGTCACGGCCACGGCCGGCGTGTCCACGCTCGCTGTTATCGTCGTCTCGTGGTCGAGCGACCCGATCGTCGCGCAGGCTTCCGACG
CCGCCATGCGAATCAAGGTGTTGCAGTTCTTGAGCCATGGGAGCCAGAGTCGAGTGGCTTCGCTTTTACCGACCGCGTCACCCCGCCTCGTGGCGTTCTA
CGTGACGTCGCCCGTGACGCGCCTTTGTCGCCCCGCCCGTGACGCGCCGCTCGAAACAGTGGCCCCGGAACACTGCGACGGCAAGTGGAGCAGAGGACCT
TTACGCGTACTAGTACGTCGGTCTGTCGGCGCTCGCGGGCTCCACTATTGCGGAAAGACATCGTGTCCAGTGCACTGTTTCAAGATGCTGGATGCAATAC
ACTGTAACTGGAAGCAGCAGTTCGCACCTCGGTGGCTCGGACCGCCTCTCGCGTGCCATGGACGGATAGAACGAGGTGGGCGCGTAGGGTCGTGCATTGC
GCGAGCGTGTCGTACGCAGGACGCACGGTTGCGCTGTGCTGCGCGTGGACGACGCAAGCTCGTCGCTGAGCTCTGGTGCCAAATTCAGAGCTGCAACCAA
GCGCTTAAGACGGGCAGTGCGTGCTACCAAGGGCATCCTTGGTGCTATCGTTGCTCGTGGGGTGTATAGTATATACCCGGTTCGCAATGGTATCAATCAT
ACTACCGCCTACTAGTGCAGGACTTCGGTTCCACATACGACCTGTAGAACGACGTCGACTCGTCTAACAGTGTGTATCGGTGGTTCGATCTCGCCTCAAT
CTTTGGCACATTCATGGCGGCTGCATTTAAACCTCGTGCGATTCATGTTACTGAAACCACGGTAGCGCAGTCGTTGGACAATGCTGATGGTGTGATCGCA
TCCGCGGCGATGAGGCGTGGCGCAGGGCCGACACGGTCGCGGTGGCTAGGAAGCAGGATCCTGCTGTGTGCCCACTCTGGCCCGAGGCTTCCGCGGTCCA
TTGACACTCAATTGCTTCGTGTACCTCGTTTGGCACCGACGTGCGCTACCTATACTCATCGCAGGACGCGCGCCTTTGCGGCGGTGATAACATCACCATA
GCCACAGGGCGGAGCTCGCTTTCTATGTGCCTGTCGTCGGG