Description :
From Genome Similarity Track
Location :
scaffold_409:110- 1291
Sequence
1181 bases(100 bases per row)
GTGTTCATCGTTTTCAAGTACACAATAAATTGTTGTATAATGCGGTTGAACATGGGATACGGCAAGGGTCGTTGTTTCGATGACAAAGATTTGCGTCATC
GTTTCTTACATGATTATCATGACAGCCCTTCGGGTTGCCATCCCAGACGTGAAAAAGCGCTCTTCAGCCTTTTCCGAGATTACAATTGACCACACATATA
TCCGTGGGTACACAAGTATGTGAAGATTTGCAAGATTTACCATGAGTAAAGCCATCAAATTCCACTGATGCCCACTCCGGTTATTGGTAGTACCAAGTGA
CAGCCGGAAATATGTGAGTACGGCCTTCATATTCAGACATTCGCGTGACACACATTGGTGCAATGGCATTCTTGCGTTTGTGGACTGATTCAATAAAATG
GTTCAACATGCACCTGTTTTGGACAGATTCCTGCCGAGAAATGGCAAAGGTCTTTGTCGGAGGTTGTTTTCGACTACATGACCTTCTGGCTGAGACTATG
TCTGACCGTGACACCCGTTTCGCATTGCGACACACCCTGAAACGGACGGTCAACCAGAACGTAAGCATCGAGCCCGAGAGGACCTACGGCGTAGCTACGC
TACGTCTGTCAAAAAAAAGATAAGCTCTTCTTCTCATAGAGCTTGCGTTGAACGACTCCACGCATGTCTCGACAGGTCACTCATTATTGATCTCTGTTTT
TCATGATTGAGTACCTGCTTCCATAATAGGTGATGCCTCTTATTTTATGGAGGGGCTATGGTTGTAGAGCCACGGTCAGACTCAAAAGCTGTCACAAAGT
CAAAACGAAATTTTGAATCAATAAGACATATAGACGACATGAGATGTCGTGAAAAACAAcacgtcgatgactttatTGTGGGGAAAGTAGCCGTCGTGAG
GTTTGCTCGAGACGTAAGTGCGAAGCTCAAAATcagcaaaaagaagaagcagatAAGAGCGAACGAAAGAACAAAAATATGTATGAGGTCAATGGATTTT
TACTGCTTAGCACACCAAATTTGTCTGAACATGCAATGTTCAACTTTGGCAGCAAAAAACTTGTGCCAAAATCTATCGGATTGTATATGGTGTTGGAATA
TAATGGTGGGGCTTATACCCTAGCCATTCTTACATGCATGAGCCAACATCGTATATTTTATGTGGGTAGGCTAAAGTCGTA