Description :
From Genome Similarity Track
Location :
Scaffold_4359:110- 1236
Sequence
1126 bases(100 bases per row)
GCACTCAAGATGTATGTCCAGGATTTGGATCAGAAGGATTGGGATGAGTACGCAGAGCGGCTTCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGG
GTGACACCTCATTTTACTTGGTACATGGGTGGGATCCTAAATCCACCCTAGAAGCGGCCGTTCCGGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAG
ACGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGGCAGATCCCAAGTGAACGAACGACTGCGGAGTGCGATACAGGGTCGAGCGGATCGACACAAC
GAAGATGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAGGGGTATGCCCGCAAATTAGCCCACCTATGGC
ATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACATGCGGTAAAGCTGGAAACGGTCGGTACCGAATACCGCCTGTTCCCTGTGGTACACGTATCCAA
GCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTAGATGCATCCGACCGCGTCGACTTCGACGAAGTTCTCCTACCGGAAGAC
AGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGATCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAGT
TTCTGGTGCATTGGCGTGCATATGACGAACCTAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGGGGGAGTGTTTAGA
AAAGTCATAAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGGGGACCCATGGATGTGAGTTGGTCATGTCGATGGGATGATGAAGAAGG
GCCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGGATCGCTGATGTGAGTTGGTCACATCGGAAAGAAAGAGAAGACGAATCCACAGGGGAAGGGTGGATT
ATGAGGAAGGAGTGAATGGTTATGCATAAGAGTGACGTTTTACGTGCGAGGAGTCATGTTTGATCTCAAGCACGAGCTATATCGAAGGGCCCCAACTATA
CTGGCCCAATTGATCCTGGGTCATGG