Description :
From Genome Similarity Track
Location :
Scaffold_1154:11- 5802
Sequence
5791 bases(100 bases per row)
CAAAACAAAGGAGAAAGTGAAAGCGGAAACGGTTATGCATTTGCAGATCTCACCGGGTTAAGCCAACACCGTACCCTAAACCCCAAGCCCGCTAGTCGAA
GAAAACAAGAAAAGAAAACGAAAACGAGTAAGACTACGCGGAAGAAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAAGCTGGATCCAGGTCAAGCTGG
TCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAACAGTTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGA
AGATCCAAGGGAACCGGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCT
GGTGTGTTCGAAGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAA
GGTCGCGCACTATGGATCCAGTGTCGTCGCCGAGAATCAGCCAAGCTGCGTCCTCAAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCTGA
ACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCCCGGTGAACGTGAAAGCTCGGGAT
CCAGTACGCCCTACGCGTGATTTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCGAGGTAATC
GCCTCACGGATCCAGTCCCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGGCACTTCGAAGCTGCGATGAGTCG
TTTCCTAGCCGAACAGAGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGAC
AACTCTCATGATGAGTTCGACCCAGACGATCTGGATGGCCCATCCACTTCGGCAGCCGTGGTAGCAACAGCCCACACCGGGGCCAGAGGATTGTTCCCTG
ATTCCGAGGGGCCCGGATTTTCAGCCTTTGGGCCCTAAAAGATTTCCCCGGCCAGATTGGAAATGAGGACCCGGAGGGAAAACGGGTTCACCCAGATTCA
ATTTCGGCCTTCTGGGGAGATCAAGCGTCGGACGTTGAGAAGTGTTTGACCTTTGCGGATTTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGG
GCAGATCCACCAGGAACAAGTGGCCGGATTTGCTGCGCAGCTTCCAGACCCAGTACTGTAAATTGGGAGTGTCGGTGGCACGACAATACTACCATGATCG
CCGCAGATCGGATGAATCCCCGCTGGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAATCAAGGATGGGGGATCCAAGGTACTGC
GGGAACACGTGGATCACTTCATCGAGACGTTGGGAGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCTTCCAGACGCAGATGAGCTTAAAGAAGT
GCTGCGGGCTGTGGACCGCGCGAAGCACCGTCACAAGAAGGCGGCGTTTGGATCCGGCAAGTTTTGCCAAAAAGCTCCGACGCGTACGGCTCCAGCTCGT
CGTGTCCACCAAGTCACAGCGCCCGGCTCAGGAACTGAATCGGGATCCGACGGTTCGGACTCCGACCCAGAAGATTACCGCCGAGTCTGTCTCGCTGCAC
ATAACAATCGTACGGCGAAGACCGGAGACAACTCTCGATCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGAC
CGCACAAATCAGGTGCTCGCAGTGCGGATCCCGGAAGCACACGGAATCTGGATGTTGAAAACATCTGGTCTGTGAGAAGTGCGGCAAGAAAAGGGTCATC
TGGAAGATCATTGCTTCTACCTGTGTCGTGGGGTGTGGCGAAGATTCACGAACGTCGAGCAAGTGTCCGAATGAAGAAATTCTACCACCAGATCCGCCAA
TGGTTTGACTCAGCCCAGCACCTAGGGGATGTTGCCAGAAGTGGCCGAGAAGAGATTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACCAGCCGAGC
GTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGT
GTCTGTTGCCAAGGTTTCTAGTTTGCGCCCAAGTGGATGAATTTGCCAGATCCGAAGTCTCTCCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTA
TTGGGAGAAACGCCAACCTGGTCGATTGTTTGAGTCTACCAAAGGTGAGGTCATTGCGGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTGTGGATCT
GAGGATGTTGGATCCATGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCA
AGATCAACAATGAAAAAGCAGTCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGACACCGCCTTTGCTCGTAAGGTTGGGCGCCAAGTAGATGG
GAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTGCCGTACGAATGGGAGAACTCGGATCAAGGTCACGCTGGCAGGTTGTTTGGTATACTGG
TTCGATATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCAGCCGGAGTAAAGTTGGATCTGGCGGATGGGACAC
TATGTTTCCCGGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTACGGGGCGAAGATGAGGATAATAAGGGCAGATAGGACGACCTGGATCGA
GCCCGGAGAAACCTGGGAACTGCCATATCGGTTAAAGTGGATGGAACATGAGCAACTGTGGGTCACACGGGGCGAGAAATGGGTGCCTACCGTAATCCAG
GGACCAGGTACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGATCATTATGAGGAGATCGGGCGATGGCTAGCGAAGGACGGTATCTCTAG
GCGACCTGGATATGTGTCAGTGGGGTCCCGTCGTTACAGAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGGGAGC
TCCCGGGGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATGTCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGA
GGTTGGATCCACGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGAGCTAAAGCCGAACAGCCGGAT
CCCGCTGATCCACAAGTGGATCCGAGTTTTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGTTTAA
ACTCGTTAGAGGACCGACTAGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGATCCCCCGCAGACAGAAGGACTGCCAGGCGAAAGAGGGTCGCG
GTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAAGGCATGGC
GGTGATCCCGGAGGTACCACTGACCACAGAAGAGGTCACGACTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGT
CAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGCAAAGGTAATGCATTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGA
AACCGATCGCTCAGAGGGTGCGAAAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTC
AACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGAATCGA
TTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACAGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAG
TTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCA
GATCTACCAACGTCTAATCGATAACGCCCTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGTTGGATCCGGGGAAGATCGTACGGAAGTAGATCCA
TTTGAGGCAGGGGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGAACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGT
TGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCCATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTT
AGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCGTTAGCCGACTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCC
TTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCACTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGA
CCACTCCAGCTGTCCGGATAAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGGATCCACGAAGAGATCCAAGTGGTATGACGTCAGAAGAGGACCTAAC
ACAGGAGCTGGATCCACCCCGAGACCAACAGAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGA
GCTCAACACGCATTCGTGGAGCTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTGATAGGTTATGCCA
GTGACTGGGCCGTCTCAGCAGCTCAGGTACAAGAACATGAGGGCATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAATTGAACTA
CGGAGCAGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCT
ACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTTTGGACACTGGAGATTGTGAAATGTTCGAAGGGGGAAG
ACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTTAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGAT
CCAGATCCCTATCCCGACGATACAGGTGGATGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCA
ATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAGGCGGACTATAACGGAC