Description :
From Genome Similarity Track
Location :
Scaffold_1885:11- 3692
Transcript NameFunction/comments
Phyta_totarag13813hypothetical protein

Sequence
3681 bases(100 bases per row)
AGTCCGGGGTTGTGCTGTAGAAGGCCaatttgactctgaattaTATGTTAGCATGTCCTAAAACCTATCCTATGGTTCCCATACAATTATCTAGATCTCC
CTATGCTCCCTTGGCTTCACTGGCTCTCCTTGACCGTTTGCGCCATCAGTGGGACTTAGATCGAGGCCTCGTTCTTCATATTGGCGTAATccctgtcaag
atcgataatCTCTGATTCTTCTGATCCTCATCAGAAGTGCTGAGAAcgtagccatcaatcttggggTCGTCACACTTCTGGGTataacttcgtaccttgg
tcgatcttgattgatgtAACTCGATCGACCAGGAAACTTCCACGTCCACTTTACCACTGCCGTCCCTTGCACGAGTGACAGCCGTACAATGGTATTCGCT
CGCTGCACCTTGGTCGtcattctccaacttgccGACTCACAACCTCGTCCGCGCCGCCTCGTGTCAtgtcgcctgcagcttccgGCGCTCGGTGTCCTCG
TCGAGATCGCGCGTCTCCGTCTTCAAGTGCTGTGCCTGCATCGTCGACCGGTGCGCCCCGTGCTCCAGCCCCGACTTCCACGCCTCGacctgcgcctgct
gcgtctgcggaTGGGTCTCCTGCAACGCCGGCTCCAACCATCGACCTCGATTCAGCTACCGCCATCGATCTCGGTTCTGCGCATGCCGCTCTTAATCCGA
CCACTGGATTGCCTCCGTCACTAGCCAACTTCCACTTGTTGAtcgcagctgcttctgctgctgtcgatacTGCTGAAGATCGTCGCTCCCCGGATGCCAC
GCCATCATGTCCGGAGTACACCTGCCACGCGTCGGCTCCAACAGTGCGTCTCGATCGGTCTCCTGTCAGTCTTTCCGTTGTCTTCGGTTCGCGTCAGGGC
GTCTTGGCCACTTTGCAGGAGATCGTGATCGCCGTGCGTCGAGAACCCGAGTTCTAGCAGCTAAAAGAAGAACATGTCGATTTTCAACGTGCACACATCG
TATCGCTTCAGCATGCTGGCGATCTTCACCGGAACATGGTGTTGATCTTGCGTCTGGTGACGTCGGGGCTCAACCATCGGACGAGATCGCAGATGCGGAT
GAAGCTCCCGCGTCTGCAGAAAATCGTGCAGCAGTGGGAGGTCAAGTCGCGCATGATTCAGAAGATGATAGCAGACTGGGTGAGGACGATCCTGAGCTGT
TGATGGTACATTCTCGCTCTCGATCGGAGGGTCGCCGTGCCAGCTTGTCCGACACGGGGTCGTCCAATCACACTGGTTCTGCCGACGATCCGGTCCCCTT
AGAGAGTCcaagcgacgacagctcttcCGGGGACTCGTCCCCCCAGTTTTACGCCGAATTCTAATTCTGGCGGGAGTCGATCTGCggctgctggtcgtgt
cCCAGTGGCGAGATCGGAAGGAGATCTCCATTCTGGAGCGAATGTTGATCTCGATTCTGGAGCTGCCGTGGAGGACGATCTCAGGGGTCTTGAGGGAACG
GAAGAGGAAGGTTTTAATTTGCGACCTGCCGTCACGACCGTCCCGAGATCAAAGTGGATGCCCAGCAACATACAGCGTCTCTACCGAGCATCAGATGTCA
CGCCTTGGGATCAGGTTGCTTTAGACCGTCTGCGAGTTGCCGATATCGATGTCCCGAtcttgagcgagttgctcGTGAGTGTTTCCGAGTGGATGTTTCC
AGATCTGGACCCCGCATCCACCTCCACCCAACTATGAGCTCCTGATCACCGGTGCTGCGGTCGAAGATCTAATGAGTTCGGTGCCGCCACTGTGGGGGGG
TCATGGATACGGAGCTCTTTTCACTTACGTTCATGTTGGACTTCATGCCGCCTGGATTCTGCGATAAGTATCTCGAGTTCGAACTTCGTCACTTGCAGGC
ACTATGGGAGTCCACCCATTTCTTgccgatctccagcagcatgttggcTGACGATCTCGCTCTGGCAGCTTATCACGAGAGCCGACGTCAGCGACTGAGT
CGCGCAGGGGCTGCATGGAAGAAATATCTCGGGCATGTGGTGAATGCGTTACATCTTCGCCGGTGTGATCTGGATATACTTCTCGATCCCTATTTTCTCC
ACTTTCCGAGATCTCGTATGCCCAAGTAATGGTACCCGCAGCCAGGGCCCGGTGGTGGGACGCTTGCAGACGCTCTTAAGATCGTCGACCTACAAGACCT
GTGGCGTAACCAGTTTCGACAGTGTCCCGCCGATCACCCAGCGATGCAGATCGCCAGTCTCGAAGATAAGTTCGTGCCGCCCTCCCGGAATCCGTGATCT
TCGATCTTTGACGCCGTAGGTACTTAACTTAATAGCGCGAGTTCCCGTCGGGATCTCAGTTTTCATATAATCTGTTCTTGGTCGTGGCTTTCTGGATCTC
CACTTTTGCACCCGATGATCTTGACCCTTGTTTGAAACTAAGTGAATCTGGCCCATGATCTACATTTCTTCGTCAAGTCGACTTCTTTTTTTCTTTCACG
GAGATCGCATGAGCGATCCCCGTCTTCGATCTGGACAGTGGCTGCTGCCAGGTCGGATCACTCACTCACGTacatcctcttcctccataTCTGTGGCCTT
CCCGTAAattcctcgtccagcatATCACAAACTCACCAGCTCACTTCGCGATCTCACCATTCCTCCTGATCTGTGGCCTCCTCGCAGATCCTTCACCCAA
CTACTCACAAAGTGACCAGCTCACTTCACGATCCTGCTGCCTTATTGCTCCTCGTGCGACTGTATGGCCTCAAACCGGTTCCGGTTGGCCTGTTCGCGCA
GGTAGTCGTGCAATACAGCTCCGCAGTTGAGATCGGCTTCATCCACCCATGTTGGTTCAGAGTATCCCTTCCAGTGCACCAGAAATTCTCGTAGCGCTCA
CCCGTAGCGTGTTCGCCGTCCAGATCGCATTTCAGTGATGCGTTCGACCTCGTACTCGTCATCATCGAGCTCTGTTTCCCAGCTATCCTCAGGCAGTAGG
ACTTCATCAAAATTAAGgcgatcttgatcttggacagCTAGCCGAAGACGCGGACGGTCAGGGAAGTCTCGTACGGGCTTAAGCTTCGACACGTGGATCA
CGGGAATAGGTTGTACGTCGTGCCTGCGATCTCCAGTCGCACGGCGTgttcgtcgatcttctcgaccACTCTGAATGCTCCGTGCCACATGTGAGCCAGC
TTCCGTGCGTAGCCCTCCTTCACCCTGTCCAGGTATAACCAAACCTGGCTGCCGACTTCGATCTCGTGCGGACGCACGGACTCGTTATGGCGAGCGGCTC
TGGTTTCGATAGCTTCACGCAGCTACTCGTTCACTTGCTCACGCGCCTGTTGGCAATGCTTCTGGATATGGTATCGTCACCTTCAAGGGTCGCGATATCG
GCGCCTTGTCGATCCTAACGGGATCATCGCTTCCAGCGTTGATCTTGGGTCCCATCCATGCACCAGATAGAAAGGCGTATCGCCGCGCACTCGATCATGA
GCCGTGTTGAGGGCAAACGTGAGGCGCTCTGCGTACTCGTCCCAATCCTTCTGATCGACGTCTGCGACGTACATCTTCAGTGCTCGCGTTAGCGTCTGCA
CCATCCGTTCAGCAGTACCGTTTGCTTGCGGCCGATACGCCGTAGTCGCTCGTTGGCGTTGTTCGATGATCTTGTTGAACG