Description :
From Genome Similarity Track
Location :
Scaffold_1136:11- 3612
Sequence
3601 bases(100 bases per row)
ACCACAGGCAACTTGCACCCGTGCCAAACAATTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGCCCATTCTCTTATTTCTGAGAAAGCACT
TCACCACAACATCGCAGTGGAGAGGAGGCGCAACGCTGAGCTGCACTTAGTGACGAGCCATTGCAGTCAAGTACGGAATTATTGAGGTCATCATGTGATC
GACCGATGCCTCCGTACTTTCAGCCAGCATGGCGCGCAGCGAATCTTCGGTGAGTGGTGGTGTACCACCAGCAGGCGCAGGAGGAGCAGCAGGAGCCATC
TCCGCGGATTCAGCGGCGACGGGGAGTGCTGCAGGAGCTACCGCAGGGAGTGAAGAGTCCGGGGCAGGAGGCGCCGGAGGACCAGTTGATGACGCTGCTG
TCGGAGGAAGCGTAGCAGTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTCAAAGAGTCACTAATACTAAGTTCCTTATCCAAAG
GACACTTACAGCCCAAGACCAGGGCTTAAAGTTAATACCTTAACTTTTATGCTTCAAAACCAGAAGTGTTTTATTTACTATTATTGCGGCCAAGCCGCCT
AGGGGTAAATGTATCTGTTTAACGTTTTAGCATAGTTAAACCTAATCAAATGCATAACGTGTGGCTTTTAGTCAATATACTGAGAGACCTTGTTAACTCT
CCATCTTATGTGCTTAGAGTTTGTTAACTCTCCGGGTACTTCGTACCCCTGTGTGTTCAACACCATGTAACCCCGTTACACTCTCCTCCACTAAGATGAG
AGCATTTCGTTCTCGAAACTTACCTCAGCGAGGTCACGTCTTGTTAAGACGGCGGAGGTTACTACACCGCACACCAGCGTTGTACAGCTCCGTGAGCTCA
CAAACGCCTACGCATCGTTGATGCCCAACTTCGCATCGTCGGCCCACGGCCCAATGTTCCAAGCGCAGCGCGCATCTTGCTCTCAAGCGGTCTTAGACCT
ACGCTCGCGCTCCGCGCCTACTCCAAGAGTTACAAACCGCTTAGAGCAATGCTCTTGACTCATTCGAGTCGTCGACAACAGCTCAGCAGTTGAACACTCG
CTTCACAAGCGATAGGCCGGTGGTTCGAACCCACCAGAGCACAGCCCTCTCGTTCCATGAACTGTTGTCCTTGAATGGACAAGCTTAAGGGCAACGCCCT
TTCAGCTCAGTGGTCGTGTGCTGGCTTTGGAAGCCACAGGTCGGTGGCTCAAATCCACCCGGGCGCAGCCCTCTCATACCATGAGTAGTCCGTTCTTGGA
CTGACGTACGGGCATAGCCCTTATAGCTCAATGGTAGAGCTCCGGCCTGTCAAGCCAAAGGCCAATAGTTCGATCCCCGTCCGGGATACCACTTTCGCTG
TTACAGCGCATCCACATTTGGATCATGCTCATTGAGCAAGTTGTTTCAAAACAACTATGCGTCTAATGAGACGCTTGTGCCTGAACCTTGTTCAGCACAA
CACGAAGCACCTGCTTCCTTCGGGACCATGTCCCTAACACTACGAGGTCTCTCCACCTCCTGCTCCCGCTGCGAGCACCGCTCATACGTACGAGCTGGCT
GCTGCATCCACTAATCAGAGCCTGAGCTCAACTACTGACCTGATCGCTCCCCACTCTAGTGGGAGGCGCCCAGCGCCTGGCGACGCTGTCGCACGCCATG
GTGGCGCTTCGGCACATGATGTGCCCGGTCGTAAGCGTCAACGACGTCAGGGCAATCTTGCCGGAGGATAACCTCAAACTCCCATGTGTTCTGTGAGTGA
GGGTAACCCCTCCACTTCACCAAGTACTGGGTACGACCATGGCGTCTACGCCACGCCACAAGGCGTTCCACGTGAAAGTGGAGCTCACCATGCTCATCGA
GCAGAGCAGGAGGAGGCCTTGCCTCAGCTGGGCTCTCGCGGGGAGAGTCAGCACTTGCCGGAACGACGTCTGCGTCCATACGACGCCGGCGTCCACGACG
CGAACGTTCACGCTCACCGCCCATCGGTCGATCTCGAAGCGATGATCCACCTTGTGGATAGGTTAGAGCCACCACTGTTGACTCACAACCAGGTCTCGGA
CCTTGAGCGTCCAGTCGCTCGGCTGCACGTTCAGCTTGTCTTGCTCCTGCATCTCGAGCACTTCGCCCCGCGACCTGTGGCTCTGCCACATGCTGTCGTT
CAGCCTCCCGTGGCTCTACCACCTGCTGTCGTTCAGCCTCCCGTGGCTCTACCACCTGCTGCCCTGCTGCTGTCCGTGGTCTAGCCACTGTTGGTGCCAA
CGCCTCCGCGCTCACCTGAACAGGGTCTTGATATGGCTTAAGCAAGCCAACATAGAAGACCGGATGCGTGCGCATCTTCTTCGGAAGATTGAGCGTATAC
GCTAGGCCCTTCCTGGCCACGACCTTGAACGGTCCTATGAACCGAGGTCTTAACTTCGTCTTGAAGACTGCAGACACTAAGAGGAGGAGAAGGAGGAAGA
AGAGGAAGAGGAAGAGGAGGGTGCTATCGGTGAGCTACGGGAGGTCTCGAATGACCTCGACCAGCAGCAGGAAGAGTTCCAAGCTGCCCAGCGTGTGCGT
GGGGGTTCGGTGGTGGCACCCGTCAGCCAGGGAGCTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTAGAGC
TTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGCCACACTTCTAGGGGCATCTACGAAGGTGCCCTTGTTCAGAAAGAACAGTTGTTCGCTAGCAACATGGA
GGCTGCTCGGTGTGTGCTTCTCGCGCCACACCGCATCCCTCTCAAGTACTTCACGACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTCTT
TGGGGATACCCCTGGATTATGCCCGAGAGCTGTACCACGTGGAGTTCTCGTGAGGACATGCTCTGGGCATGGGTGGAGACTCTTAAGTACTCACCCACGG
AGTTACGGGAACTCCATGAAGATCAGCTGCTGTCCCGTATCCTGGACCAGCGTGATCTTCGTGTGAGGCTTGCCCACTTGATCAGCAAGCGCATGCTGCC
AAGGGACATCCTGAAGCGGGCGGCTTCTAGCGCTCACTATGAGCGCGGGTACGGAATGTATTCATCGTCCGTACCTCGTTCGGGCAAGAATCCCCGGACT
ACTTATAAAGCTGCCGCCGCTTCTGTTCCCAGATTGCGACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATGGGCTCCCACGAGTTCTCGGAGTGGGC
ATAACCCCTCCACCTCACAAAGAGCTGTCGTTTACCGCGACGCCGTTGCTCCTGGAGGATCCGCTCCACATGGAAGTGGACATCTCCATTTCGGTCAAGC
AGGGGCGGAGATGCCCTCGTACAAGTACGAGTACTCGGCGCCTCCCGAAAGCCACTCTCGTCCGAGTGCTTCGACTGCGGGTCCGACACAGGGCCCTGAG
GTTGACCGCCTCCGTCAACGTGTCCTCGTGCTTGAGATTGCACTTGGCCTTGGGACTGGCGGTGATGCTGCCGCCCAGGTCGGGAATTAGGGCGAGCTCG
C