Description :
From Genome Similarity Track
Location :
Scaffold_1893:11- 3366
Sequence
3355 bases(100 bases per row)
GCACTGCAGTTGTCTTCCCTGCATAATTTCATACAGCTTCTTTGTAGGACAGCGATACTTGCCCGGCGTGTTTGAATTCTCCACAAGTTCGTTGAAGTGC
ATGTGTTACGACTTGACAACAGGAGATGGCATCCCTTGTACAAAAAAAAAAAAGACTGAAGATGAGCAAGTCTGCTACCGTGAAGGCGGGGATCTACACG
CCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTAGATCCAGGGGCAAACGA
GCCCGCGGAACTGGATCGGCTACGTCAGAAAATCAGGGAAAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAA
TGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGAAAGTGGCACCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGC
CAAGATCATCAGCTTCTCAACGTCCCCGTGGGCCTCTCCGGTGGTAATCATCATCAAGAAGAATGGGGTGGATATACGTCTGTGCATTAATTATCGGCTG
GTTAACAGCCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGG
CCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGAACCGGATGCCGTTTGG
ATTGAAGAACGCACCCCAGATCTACCAACGCATGACCGATAACGCCCTCTATGGATTCACCCTAATACCGGAACCCGAAAGGGGTGGATCCGGGGAAGAT
CATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTAGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCTCGG
CGAAATCGTGGGATCAGTTGTGTGAAAGAGTGACATCTCCTACTGGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTTAAGAGCTATTGGGGG
ATGCGCAAGGTGGATTACTTGGGCCATCGAGTTTCCAAGGAGGGATTAGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGT
CGTTACGAGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCACTGTTTGCCGCGGTATTGTACGAATTGAGAGA
GGTAGATTTTGCCGCGATGACCACTCCAGCTGTCCAGATGAAAATCCAACAAGCTCTGGCCCAGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTAGG
ACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAACAGG
CAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAGCTGAGGAACAGAATCGCGACCACGCCTATCCTCCGTCACTTCGATCCGGAACGTCAACC
TACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTTCAAGAACATGAGGGGATCTGGTATCCAGTCACCTTCGTCAGCCGGACACTG
AAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGACCCATCC
GGATCCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGATGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCT
GGAGATTGTGAAGTGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAGATGGATGAGGCGCTGACTAGGATCG
CCCCTAAGAAAGAACCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGCAGACGAGGATATGTACGTCCTGAGTTTCGATGGATCCGCTCGCGT
ACGATGCGGAGGCGGGGCGTACAGTGCGATAATGTGGAGACTACCTGGATGGGAAGTTGTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAAC
GAAGCGGAGTATAGCGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCAGGTGATTTGTGGGGATTCAAATTTGGTGATCAGAC
AGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGGTGATCCACCTGCGTGGGTTGGATGAATCACGAGTTGGTGC
ATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGA
TCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGATCCGGGAAAAGGACAGTCCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGG
ATCCAACCCCCAAATTCTCGAGAAAACATTTGTGAAGAATGTCCGCATCGAGCAGGTCCTCAAAGCACAGAACGAGGAAGCGTAGATCCTAGGACTAAAG
AAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCT
TCTATTGCCCCCCTAACGAAAGAGAGTCAACGAGGATCGGGATGGATTGATTGAGACTGGTGATGCAGAAACCCTTACAACAGGATGTCCTACCACCACT
ATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAGTGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACG
GTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGGGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATC
ATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACCCAGAATTGTTGACATGGGTGGACCTGTTTACCGGATACGTGGTAGCCAAAG
CTAGTGCGTCTAGAACTGCGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGTTTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCC
AGGCTTTATGTCTGATATCTTTGGAGCATTCGGGGAATGCCGACGAGTCTTCTTC