Description :
From Genome Similarity Track
Location :
Scaffold_1502:11- 3279
Transcript NameFunction/comments
Phypl_g13569reverse transcriptase

Sequence
3268 bases(100 bases per row)
TCCGTCCTAGGTCGGAGATCgtacatcgacgacatcctaATCGGCGGTACGTCATGGGAGATTTGTGCACGAAGGTCGAGCGACTGCTGGACGTCTGCGA
ACAATGGCATCTGTCCATCAGTGTGGAGAAGAGTGAGTGGGGTATGTCTCGAGTCGACTACCTGGGCCACAAGGTCTCTGAAGCCGGAATTGAAGCGAAA
CCGAAGAATCTGGACTCGCTCGCGGCGTTGGAGTTCCCGCGCACGCTCAAGGGTCTGCAATCGTTCCTAGGCAGCCTGAACTACTACCACCGGTTCATCG
CGGAGTTTGCGGTCTACGCGACTGCACTGTACTCCCTCACGGAGCTTGACTTCGAAATGTACGCCACCCGACCGGAAGTTCACAGCCAGGAGAAGTGAAT
ACACGCTCTACGTGCcttcgagacgctgaaggccaagatTGCCAATACGCCGATGCTGAAGCACTACGATCCAGACCAAGAACCGGTGGTCGTCGTGTAC
GCCAGTGACTGGGCGATCTCCGCGGTACTCGCGCAAGATCATGACGGTGTGTGCAAGCCAGTGAAGTTCACCGGCCGCACACTCAAGCCCAACGAGCTGA
ACTATGACGTCGCCGAAAAGGAGGTCCTGGCTCTGTTGCGCGTCTTGAACGACTGCTTCACGATGTTGGCCGGAAGGGCGATCCGTGGCCTGACGCGGCA
TACGACGTTGGCGTGGCTTTTCCGATCTAAAGGGCTACAAGGCCGACTGTCGCAGTGGGCCGCGATACTCTCACCGTGGAGACTGGATATATTCCAGTCC
ATGAAGGGAGAGGAAGAGATCCTGGGAACGCTGGCGGCGAGTATCACGCCCAGGGCGTTCGtcgacacggcgctggaagagatCGCTCCACGTAGACGTC
CGTCGCGGATCGCTGTCATCCCGATCCCGACGGTTTTACCGGACGATGAGCTGCATGTCATCAGCTTCGACGGATCGGCCAAGGCCAAACACGAAGGCGG
ATCATTCAGCGCGATTGTCTGGAAACTGCCGGGTTGGGAGATAGTCCAAGCTGCGTCGGGCTTCGCGCCAGACCTCACGGTCAACGAGGTGGAGTACCGA
GGATTGCTTCTGGGGTGTTCGCTGCACGAAGGGCTAGAGGTCGCACGACTGGTCGTCTGTGGAGACTCGAACCTCGTCATCCGACAGATGCGTGAAGAGA
TGGACTGTAAGTCACCAGGCCTGAAATTGTTGCGACAGCGAGGTCGGAACGCATTACAGGCTTGGCCGCGCCATGAACTCTTCCACGTACGCCGGGACTG
GAACGCGAGTGCGGATATGCtcgctggacaagcactACAACGTCAGAGTGGGGTGACTGTTCGTGGCCTGGACGAGATCCAAGACGTTAAGACACTGAAT
CGCCTGGGAGAAATCATCCAACCGGAACTTGGAACGTCGGATCGGTCTCCTCAGCCTGAAGATCAGGCCGATGGAGAACGCAGAACGGCGCAGGTGTTAC
CGGTGGCCACGCGTTCCACCGCTGCTCGGGACTCGATGCCAAGGGATCGAGAACCCGAGGCTCTACAAGAGCTCGTTGTACAGCAACTCCGACTGGACCG
CGTCCGCGTCGCGCAAGACGAGGAACTGTGGATCGTGAGCCTAAAACGATACCTGAGGGGCGATCTCGACGAACTCTCACGACGCGAAgcgaagaactgc
agcaagatTGCCCACCCGTACAAGGAGGGCGAGAGCGGGCTGCTCTACTATCGCGCGAAAGGTGACGAATCGGCCGAAGACCGCGACACGATCCTAAAGC
TTGTCATTCCGGAGACGCTCCGCGACGGTGTGTTGCACCACTATCACGCGAGTTTGGAGGGCGGACATCAAGGCGTCGGCCGGACGTATCAGCGGCTGCG
ACGCCACTTCCACTGGCCGGACATCTTCCGAAGCGTACAGCGCTACGTAGGAGAGTGCACGGACTGCGAAACTGGGAAGGGTCGCCCGACGATTCAAGGC
GAGTCGCCGGGGAACATCGTCGCGACCTACCCGTTGCAAGTCCTGGCGATGGATCACGTCCCGTCCTTGCCCGCGTCGCGCGAGGGCAACACCAAGTTAC
TCGTCTGGGTGAATTTGTTCACGGGGTTCGTCATCGCGAAGGTGAACTCGTCGCGGACGGCGCAGACGGTGGCCGAAGCGATCAGACACGATTGGGAGCC
AGGCTTCATGTCCGACTTTTTCAAGGCGTTCAACAAGCTGATTGGCCAGCGACAACGGGCGACGCTTGCCTACCGACCGCAGGCGaacggcgctgcagaa
cgcaTGGTGCAGACGATCACAAGAGCGATTAGCATGTACATCGAGGACATTGACCAGCGCGACTGGGACGAGTATGCGGAAAGGCTTACCTTCGCGTTGA
ACACGGCCCACGATCGCACGAGGAACGAAACCCCCTTTTATCTTGTGCACGGATGGGACCCGAGATCGATACTGGAGGCGACGCTGTCTGTCAGCAACAC
GTCTCACCGCGAGGCTGAGGTCAGGCGCTGGCGATTGCGGATCCAGAGGCACTACAAGATCGCGCGGACGCAAGCGTCGGAGTTAGTCCGAGAGGCGGTC
GAAGCGAGAGCACGACAGCAGAACGAGATCACGACGGAACACGTGATTGAGGCCGGAGGGAGAGTGTGGCTTTACCTGAATCGGGTGAAGCCAGGGTACG
CGCGCAAGCTTGCGCACATGTGGCATGGGCCGCTCCgtgtcgtcgagctggtggacacgTACGCCGCGCGACTTGAGACGAACAGCACGCCCTATCAGCT
CTACCCGGTCGTGCACatctccaagttgaagcccgTCCGGGAGTTCCCGACGCGCCCGGCGATACCGCTGACGGTACCGGCCGGTGAGCGTTTCGATTTC
GATGAAGAGCTCTTGCCCAAGGACAGCTGGGAAGCAGAGGAGTTAGATGATGACACCTTCGAGGTCGAAGAGATCCTCGACATGCGCGAGGGCCGAACCA
CGCGATATGGCCGCACGCGGCGCGAGTTCGAAGTGAGGTGGAAGGGTTACCCAGACACGACGTGGGTCGATGAACTCGATCTCAACTGTGGTGGAATCCT
GTACGACTTCTTGAGGCAGCGCACGGGGCGCAACCGGTTCGGCGTGATGCAGTCGCGCgagaacgcggcggcggagccCGACCAAGGTGGGTGAACGCCT
TGGTGGGCGTGGTGGAAGTCGGCAGGAGGGCTGCCGACGGGAGGAAtcgtggagacgctcgtTCTGGG