Description :
From Genome Similarity Track
Location :
Scaffold_2797:11- 2875
Transcript NameFunction/comments
Phyta_totarag14843hypothetical protein PHYSODRAFT_262200

Sequence
2864 bases(100 bases per row)
GTCGTGCACTCGATAACGGTTTGCACGAGCGCGTAGGTGTGGAGTCAGCTCTGACGTGCTATGTCAGAAGGTGTTGACACGTAGCCAAGAAGTTCTTTCG
CGTCTGCGTCGAGTGCATATGCGgccttcacgtcgtcgatcagagacgacgacggggTACTTGTACTAGCGACGCCAATGCTATTGGCGTCGGTTTCTTT
GACAATGTAGTCAGGTCGACGCGGTAACGCGTTGACCACCACACTCAGCCTTCCGGTGTGTACTCGACGTGGAAGTTCTATTCTGCAAAGAACGACAACC
ATCTTGCCATTCTCTGGGAAGTGTGCGGCGCCTTAATCGCCGTACGCAGTGATGCATCATCGGTATAGACCACGAGCGGTTTATTCTCAAGTAGATACAC
TCGAAATTTGGCGAGCACATACTTCATGGCAAGGAGCTACCGGGTAATTGCGCTTAGCTGGCTTCAGCTGACGCGATTGGTAAAAACCACACGATCACGA
CCctcgagatcgagctgcatcaacgcgCATCCGATTGCAAAGTCGGACGTGTCACACACGACGTGGAATGGACGATCGTGGTCGGCCACCGCCAAGATCG
GCGCCTCAGCCAAGCCCCGCTTGACTGCATTGAATGCTACTTGGCAATCGATAGTCCAATTGTACACAGCTTCCTTCTTTAGAAGCTATGACAGCGGGTG
AATCTTGCCCTCATAGTTCTCTACGTGCTTGTACAGGTACATGGCAGTCCAAGGAACTGTCTCAGTTCCTTGACATTGGATGGCTCCGTCCATTCATTGA
TCACACTGACCTTCTTTGGGTCAGGGCGTACGTCATTCTTCCCGACGAGATAGTTTCTGGCTCGGCTCAAAGATACACTTCTTCAGGTTCGCGTAGAGCT
TGTGCTTGCGCATCAGCTCAAACTTCTTACGGATATGCACTTTGTGCATCTCAACAACTGTCTTCTCGTCCACAGCCCGTCTGTGAacgaacacgtcgtc
gaagtagctTGGTGCGAAGTCGCGCACCTAGCGCAACAGTGCGTGACGCACTGGTTGAACGTCGCAGACGCGTTCTCTAACCCCTGTGGTATGACGAGCC
ACTCCCAAATCATACCACTTGGGGTGCTTACCGCCGTGAGAGGGATGTCGCCCTCACGTATCAAGATCTGATAGAATCCGCCTCTCAGATCAAGAGCACT
GTAGATGGTGCTCAGGGCCATCGAATCGATGATCACATCTTTTTGCGGTATCGGCGTCTGCGCCGGTATCGTCGCatcgttcagcttgttgtaCGCATGA
ACGATGCACCAGCCACCTTGGGGCTTCATGACACAGAACATCGGTGCAATTGTGCGAGGGTTTGGATTCCCGCACTTGGCGTGCCTTGCGACGACTTTCA
AAGAAGTCGTCCATTGCCTTCACTTGGTctggcggcagtggccactgcccCGTGACACAGTACTTCATGCCCGGCACGAGGTCAATCTCGTGCTAAATTC
CCTTGTCCTGCAGGAGTTCCGCAGGGGTGTCGTCCGGGAGTACGTCCTTGTACTCTAGCAGAATATCGTAGTAGAGgctcgacttgagcgagtcTCAGCC
CTGCTTTTCAAGGCGCTTTTTCTTTGTCTTGGNCTCAAGAGTAATACTCCTGTACTGAAGCCCAGTACAGGTCTGCGTCAAGACATTCAATGTCTCGACG
CTTGACGTCGGACCTGGTGTCTGCCCAACAGGCATCTGGTTTCCCATCTCGGTCCCGGACCGAgactcgcgcagcttcttctgcttgtgctgtcgtttct
tcatcttgcggAGCCCTGCTCCGCGGGCGCGCGTCATCAAGCCCGACTTGACACGCAATCGCTTCTACGCGCATCTCTGCTGCACGTGAGCATACAAGCA
TTTCTTGTGCTGGATTTTTGAACCGTCCGCACCGCTCACAGCGTCAACTCCCTAAGCTGACAcaccttcgtcgcctcgacgccCTTTGGTGGAGGTTTCT
GTCGAATCTGATCCAATCAGATTTGCGTCAACTCCCCGAGCTGATACGACGCAGTCACAATGCTCCTTTGTAGCGGAATCATCCTTTAAAGCTGAGTTTA
TCACATTCTTGGTGTCGCTTCCCAGAACCGACACACATTCACTCAGTCACGCCCTGTGCGTTGAGATAGCAGCGCCCAGCGCTGTCGCTACTGGAAGGTC
GCATGCATCTCGCGATGCATGTGTTGCGCTGACAGAGCCATCGCTCACtgtcgcgctgctgcaaccgAAGCGTACAATCGtacgcttcttccagtccatT
TTGGTGTCATGCCGTGCAAGCCACGGCAtcccagcaccaagtcgaacttgtcgtctaaATCCAATACGATAAGATCTTCAGCAAATACCTTTTGTTGGTA
CGACAAGCGTACGCGTACGACACGCTTCTCAGTcttcacgacggcacctgttgtcagtcgtacttccaatACGCATCGAGGCGTTTACACCACCTTGAAG
TCAAGGCTTTATAGACTTTGCTGTCTACCAAGGCACAAAAAGATTCCGCTCGCTTCGAAGTCGCGTCCAGGGTGTCAAGGTTTGGCTTGTCATCTCGCTT
ATTGCAGTGAGAATGCCTCTGACTGGGGTCTGCAGTCCTCACTGACGCGTGTCCAATGTCAACACGCGCCTACTGGTTCCGCGCGTTTTTTTTATGATCG
CAACGTTGGCCTCTCTACCCTTGCATGGGTGCTGTGCACTCTCGCGCGAAATGGCCGATGCGTCCGCAATGGAAGCGTCATACGTCGGctccacgacgtg
gtgggtTATTCCCAGCCGTCGCGTTCGAGAGGTCCATTGGCTCTGGACCTCCCATCCTTATCAT