Description :
From Genome Similarity Track
Location :
Scaffold_1423:11- 2856
Transcript NameFunction/comments
g16715.t1hypothetical protein
g16716.t1hypothetical protein

Sequence
2845 bases(100 bases per row)
TCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTGAGCTCTTCTGTTTCACACGTCACTCTCTCGACGTCCGAAAGGATGC
AGATCTGCTCGATGCGTCCATCGTGCAGGTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTCTC
CAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAGTGATTCAACGGTTGGCTCCAACTCCTGCGTCTGCCCGGCAGACACT
GCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCCTCTTGTC
CAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTG
CAGCCCGGCTGCACGCGAGTTCGCAAGCATGTCCGGTGCGGGACGTTTGCAACCGCCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGCCTTCT
TTACCTCGACGCCTAACGACGGGGTGTCTTTCGACAAATTGTGTGTCGACATTATCTGTCGACACAACCGCGTCGCTCAGGACGCTTCGAGACCCTCTCG
AATCCGATTGAATCAGGCCCTGCTGATTCGGTTCACATTTTCTTCCAACGACTCTCGCAGTCGTTGGCATTCGCTTGTGGTGATTGGAGACAGCCGCATT
CCGCGCTGTCTCTGGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTCCTGCTGCTCCCG
AAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCGAGGA
CGATAAGTTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTATGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTC
CAATAGACTTCGAGGTGTTTTTACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGA
AGAGACTTCTCTCTCTTCGTGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTAACTCTCACTGGGGGCAGCGATCT
TCATTGCAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATAC
CCAGTATCGCCACGACGGCTCCTCACCGCGTGCACAGGTGCTGTACACTCGCGGGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTG
ATACACGACGCTGCTGGGAACCAGCAGCTGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATTAGCCGTGG
GGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTTTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAG
GTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCAAGACCAAGTACCGTGCTC
TTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAG
CTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGGTCTGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCG
AACGCAACCTTCAACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGT
AACTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACC
CAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCAC
TCTGGTTCCGACAGGTGGGGGGAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAG
CCCCGCGTTCGTATTCCATACGAACGTGTTAGTCAGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCT
TACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCGCAAGTATACTGAAACCTAGATAAATGAACCGA
ACGATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGATGG
CAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTC
ACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG