Description :
From Genome Similarity Track
Location :
Scaffold_1936:11- 2549
Sequence
2538 bases(100 bases per row)
CTACAGGCTCATCAACGGGCTGACACAGTTGATGATTTACCCCATGCCGCTCGTCAACGACTTGCTCGAAGACTTGGACAAGTATCTGTGGTACTGCTCC
CTCGACATGGCGAGCGGCTTCTGGGTCGTCCCCATGACAGACCGGGCCCGGCTCACCTCAGCCTTCATCACGCCGATGGGACTGTACGAATGGCTGCGTA
TGCCGTTCGGGCTGTGCAACGCGCCGCAGATTTACCAACGCTTGATCGACAACGCGCTCTACGGGTTCATGATGCTGTCCCCGGATGACAGCACTCGGGA
CGTCTTTGAAGACGGCGAACCGGTGAAGCCAGGTATTCACTCCGTTCTGGGTCGGAGGTCGTACATCAACGACATCCTCATCGGGGGTACGTCGTGGGAC
GACCTGTGCGAGAAGGTCGAACGCTTGCTGGATGTCTGCGAGCAGTGGTACTTGTCCATCAGTGTCGAGAAGAGCGAGTGGGGCATGTCCAAGGTCGACT
ACCTGGGCCACCGAGTCTCAGGACTCGGTCTCGAGGCGAAGCCGAAGAATCTGGAGTCGCTGACGTCGCTCGAGTTCCCGCGCACGCTCAAGGGCCTGCA
ATCGTTCTTGGGTAGCCTCAATTACTACCACCGGTTCATTGCAGACTTTGCGGTGTACGCAACCGCGCTGTATTCGCTGACGGAGACCGACTTCAGCGAG
TACGTCACGCATCCAGAAGTCCGCGGACATGAGAAGTGGACGCACGCGACGCGCGCCTTCGACGCGCCCAAGGCAAAACTCGCCGAGACCCCAATGTTGA
AGCACTTCGACGCGAACCGAGAATCCGTCGTGATCGTGTACGCCAGCGACTGGGCCATCTCAGAGTGCTCACGCAGGTCCACGACGAAGTGTACATGCCT
GTGAAGTTCACCAGTCGTACGTTGAAGCCCAACGAGCTGAACTACGACATCGTCGAAAAGGAGATCTTGGCCCTGTTGCGCGTCTTAAACGAGTGCTACA
CGATGCTAGCAGGGAGACCGGTCCGCGTCTTGACACGTCACACGACACTCGCCTGGTTGTCCCGGTCCAAAGGACTACAGGGGCGACTGTCACAGTGGGC
CGCGATCCTCTCGCCGTGGAAGTTGGAAATCTGCCGATCCATGAAGGGAGAAGAAGAACTCCTCGGCGCGCTGGCCGCGAGCATTACCCCGCGAGCCTTC
GTCGACGCGGCGCTAGAAGAGATCGCCCCACGGAGACGGGCGTCCAGCATTGTAGTCATTCCAGTCCCCGACGTGGCGCGCGACGAGGTCTTGCACGTTT
TGAGCTTTGACGGATCGGCCAAGGCGAAGCGAGAAGGCGGAGCATACAGTGCCGTCATTTGGCAGCTGCCGAACTGGGAGATCGTGCGCGCCGCGTCGGG
ATATGCGACGGACCTCACGGTCAACGGGAGCTCGACGACGTCACCCGACTCGTCGTATGCGGAGACTCCAACCTTGTCATCAGGCAGATGCGGGACGAGA
TGGACTGCAAGTTCCCGGGGCTGAAGCTGCTGCGACAAAAGACGCGAAACGCACTCCAGGCATGGCCGCGCCACGAACTCTTCCACGTAGGACGAGACTG
GAACGCGAGTGCCGACATGCTAGCTGGACATGCTCTGCAGCGTCAAGGAGGCCACAACGCGCACAGCCCCGAAGAGATTCAAGATCTGAAGACGCTGAAT
CGCTTGGAAGAACTCATCCGACCACGGGCATCGAGTCCCGGGATGGCGTCTCCAGCGAGTCCCGACGCGGATAATCTCGACGCAGAAAACCTGGACTCGG
AAAATCGCGACGCGAAAACGCGCGGCGCAAATGACCCCGCCGGGAAGGCCATGGACGCGGGACGCGGGACAGCACAAGTCCGCGCTGTGACGACGCGCTC
GGCTGCCGCACGCACGACAAAACGTAGGGTCCGACCTCCAGAAGTCCTGGAGGAGCTGGTGGTGCAACGACTGCGCCTGGACTGCATCCGTGTCGCCCAG
GACGAAGAGGTCTGGATCGTCAACCTCAATAAGTATCTCCGCGGCGACGTCGGAGACCTATCTCGGCGCGAGGTGAAGAACTGCCAAAAGCTTGCGCCTC
AGTACGAAGAGGGCGAAGGCGGGCTGCTCTACTACCAGCCGAGAAGCGACGATTCCGCCGAGGATCGCGATGTGATGATGAAGCTGGTGATCCTAGAGAC
TCTTCGGGAAGATGTACTCCACCACTGTCACGCGAGCCTGGAAGGCGGACACCAGGGTATTGGCCGCACGTACCAACGCGTAAGGCGCCACTTCCATTGG
CCAGGGATCTTCAGAAGCGTCCAGCGCTACGTCGGCGAATGCACCGACTGCGAGACCGGAAAGGGTCGGCCGACCATCCAGGGCGAGTTGCCGGGCAACA
TCGTCGCGACGTACCCGTTCCAGGTCATTGCCATGGACCATATTCCGTCGTTGCCGGCATCCTACAAAGGCAACACAGAGCTGTTAGTCTGCGTCGACCT
CTTCACGGGGTTCGTCGTGGTCAAAGCGAATGCAACAC