Description :
From Genome Similarity Track
Location :
Scaffold_1357:11- 2351
Transcript NameFunction/comments
Phyke_g11807hypothetical protein

Sequence
2340 bases(100 bases per row)
gcagatcGGGACAAGGCCATACGTGATCGGGGTCAAGACCAGGACACGATCCGGGCCCTTGAGACGTCTCAACGTGCCTTGGAAAATGCTACTACCCAAC
TGCGTCGCCAAATTGAGGTCTTGGAATGTCGGTCCTCTGATCTTCGGACACAACTGGACCAGCAAGCGACTAGTTCTCAATTCAAGCTGGATCGCTGCAA
CGCCGAGCGTGATTCTTTCAGAACCCAAGCGGATCAGACGGCAACTACACTTCAGCAGACTTCGACCGAGCTACAACGGATGACAGCGGATCGTGATCGG
GTATCGGGAGAACTGCGGTCTAAACGTAAGTCCTCTAACCTTTCTCCGATCTTGACTTGCTTTCCATTAACTGTATCCGTGTGTTCCTTTACAGGGAGTT
AGATTAACACATCGCGATCAACCATTGCTCggcttgagcagctcgtgaATACCCTCCAAGTGGATCGCAATGTcctgcaacaacttcgacagGAGAACGC
CAGTCTCACCTCGCAGCTGACCGTGGCTCAAGACACGAATACTGATCTCACAACCGAACGCGATCAGCTGATCACCGAGCGCAGTGACATTCAATCTCGT
CTCACTGGTCTGGCCTCGTTCATGCGACCGGGAGCTCTCGCTTCCGCCCCCACGGTGATCTCGACTTCATCGACACCAAGGTCCCAAGGCTCCACGCCCG
GTTCGACCCCAGTATCCGTGACTTCTCGTAAACGTCCCAGCACGAGTCCTCCACCAAATGGCCCTCCAACTTCCAAGCGGCGACTACGTGGGACCCAGAC
ACAGCGTTCGCGATCAAGACGTCCTCATCAGTCGCCTCCCTcggcttcaagctcaagtccagGCAATGAGTCTGCCTCTgagagcgacagcgaagacgac
aGTCTCCTTGCTACTCTATCTCGAACTCGTTCTCTACGTCGCCGATCCGATCAGTCCAGCAACACATCCGGACAGGATGTGTCCAGTCAGCCGATCGCGA
TCGATTCGTCGAACTCCTCCGATGACAGTGTTAGTACCCAGTCTCCACCGCAGTCCATTTTGCACCAGCCACGTACGCAGCCTGCGTCTAGTTCAAGCGG
TACTCTTCCTAGTGGGTCAggtggcgacgacagtgatTCGGATGGTGGATCGGATCATGACGGGAACTCTTCGAACTACAACACTCTCATGGACGACGCA
AGCTTGCGATCGCTCGATTCAATGATCAGCTCACGAGCTGACTGGATCCCTGGTTACCGTCATCGAAGTCGGTATACACCAACAGAAGTAACTCCATGGC
TTCTGCCCGACGTTATGATCACCAGCGTCCGTGAGCTGACCGTCAACACACTTTTCCACCAGTTCAGCAAACCTCCTAACTGGATGTTTCCTTTACGATC
TTGGGCACCACCGCGATCAACCTGGTCTCCTGATCTCATCACAGAGGCCAACGTACGAAGCATGCTTGCGACTCTCCCCTGGCAGGTGTTGGAGTCGGTT
ATTGTGCCTCGGTCGTTTGATCTCTCGGGCTGGTTCGACCAGTTATCCCACAATTATCTGCAACTGGAGGACGAATATCGCCAAGCTTATTGGGAAGCAA
CCCACGCTCTTCCGATCACGGCTGATCAGCAAAGAAGCAATGCTTATCTGGCCGCATATTATTTAGAACGCAAGCAGCGTCGATCGCGAGCCGGTGCTCG
TTGGAAAACTCTGCTTCGATTCATTCTGCAAGGAATGATCGCCGGACACTGCGATCTCGATATTCTGCTGGACCCGTTCTTCTTGCATTTTCCATGCCAA
GGTGACCACGGAATCTGGTATCCTGGACTCGGAACTAGTCCGGCGCCAGCAGACCTGattgctgcgcttcaagctgtcgATGTTGGTGAGCCATGGCGCA
ACCACTTTCGTGATCGACCCGCTGACCATCCAGCACTCTGCATCGCTTGCTTAGACGGGAAATTCTGGCCTCAGACAGATAGCGATTAAGGTACAGCTAG
TAAATAGCTTCTTGCATATTCCATAACGTCTGCAATCAACCACCACTTGCTTCTTGGTCGACTCTGTTGAGTCTCCTTTTCCTTCGTATCTTATGTAAAC
TTAAATCGAGAGGTGATTACGTCCTCTCGATTTAACAACTCACTTCACATGTACATCCCCCACATAATGTGCAGCCTCCCTGCACATCTTCCACTCCACT
TTCCCGCAACAGCCATCCTGCTACGGGCACCTACAGATCCTCTTCGTGAGACTGCATCACGTTGAAACGGCTTCGACTCGCGATCTCCCGTTCATATTCC
CGTAATAACGCACCACAATTTAGATCAGCTTCGTCTACCC