Description :
From Genome Similarity Track
Location :
Scaffold_1610:11- 2335
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1610-snap-gene-0.1Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_1610-snap-gene-0.2Polyprotein

Sequence
2324 bases(100 bases per row)
GGGCGCCATCATGCCGGACAGCCGCGAGACGATGGTGAGCCACTGGCAGCGCGTGCGCGCGCTGCGCGGCAAGTCGACCGAGGGCTTGGACTACAACTCG
CTCCAGTACTCGTGGTGCGCCTTGATCCGGCGCTGGAACGACTGTCATGCCAAGGGTGAGCCGTTCATCCGCTGGCTCGAGTTTGAGGAGGAAAAGCGCA
CGCTGCGCTCACTCGGCGCGCTGCGCGAGCGCGTCTGCAACATCGCCTGGGATACCCGTCGCATTTGCCTCGTCAACGTCCTGGAGGGCTGCTACTTCTG
CGACAATGGTGGCGCGCGTCCAACGCGCGCCGAGTGGAACGCCGAAATCGCCGGCTGGCCGCTGGACAATCGCGAGCGCGAATGGGTAGGACGGTACGAG
CGCGCAGTCTGGGAACATCTTCGAGTCGCTAGTCGCGGCGGAGGAGGGGGCACGCGCAGCCGCGAGGCGCGCGCGCATGGCCGTGTTCGCGATCAAGGCC
GCGAAGGCCGTCACCAGTCGCGCGAATCAGCGCGCGACTCAGCGCGCGATTCTTCTCGTGGACGCTCGCGTTCGCCCGAGCGCATTGCAGCTCGAGGGCA
CTCGGCGCGGCGTCATTCGCGCTCGCGGTCGCCGCGCGATAACCAGGGCCTGGCGAAGCCGATCCGCCGTTCGCCGTCGCCACCACCGACGCGATCGTCA
CGTCGCCGCGCGACTGAAGTGCCGGCTGACCTTGACTGGCGTCGTACTCGTGAACCAGATCCGGAACATCACGCTGGAGCCGCTCGCGCGGCTCCCATGT
ATCCGCATCTGGGGGATAGCCGAGCCATCGGACACGATAGCGGCGCTGCGCAGGCACGGCGCCCGTACTCGTACGGCGCGTGTCAGCGCGGCTCAAAGGC
GGATCCTCGTGGTCCACAACACGCTCCACGACCCAGTGAGCCTCGCCCGTCGAGTCAATCAGTGGCGGAGGGCCATCGCGACGGAACACCGCGCTCCGAG
ATGCCAGAGCGGTCGAGCTTTGAGTGGATCGTGATCGCGGAGTCGGAGCAGGCGAAGAACGACGCTGCGGAGGCGATGGAGCAAGCCGCACGGGCTGAGG
AGCGGGCACGCGCGGCGGAGAGCCACGTGGAGCGCGTGGAACAGCGGACGCTGGCCTTCCGCGAGACGATGCGCCAGTGGCAGCGCGATATGGAGGCCCT
GAAGGCGTCGGCGAAGCGCCGCCAACTCGAGTAGGCCGCTGCGCCGGCTCGTCGTCGGGGATCGTCGCTGGGCGGTAGGGCTTCAAGCGACCGACGTAGA
ACGTCGGGTGGAGCCTCATCGTGGTCGGGATGTCAAGCGTGTATGCGTCGCCCAGCGTCTTCATAACAGTGAATGGTCCGATAAACCGTGGCGCGAGTTT
GCTCGCGCCGAGGTTCGTAACTGATGCGTCTTTGATGCCTTCCGTTGATAACAGCACCCGGTCACCCACTTGGAACACATTCGTGTTTTTGCGGCCGCGC
TTGTCCGCGGCCTCCTTCTGTCGATCCGCAGCCTCTTGCAGAGCGTCGCGCACGAAGCGCGTCACGGACTGGCGCTGTAGGACGAACTCGGTCACAGCGT
CGTCATCAATGATTCGGGCATCAGGCTTGGGAGCGAAGTTCGCGGCGAGAGGCACTGCTGCACGCGCAGCGCCAGGGTTGATCAGCGCCTCGGATGTCCA
TCGAGCCAAAGAGGCGCCCGAGTCAGCGGGTGTCGAGGCAGCACGCGACTGGGAGCACGTGACAGCGTTCACCGCAGCCAGCGAGCCGACGCCAGCTCCT
CCCCCACCAAGCGTAGAAGCCGAAGGCGTCGCGGGTTGTGAACCCGCGGCAAGCGCTGCAGGAACGCGCGGGTGACGCGCGTTGTTGATAAAGAAGGGCG
TTAGGCCTGTCGACGCATGCTTCGCGTTGTTGATCGCGAACTCCGCGAGCGGCAAGAATCCGCTCCACGACTTGAACGAAGTCGCGAAGCTCCGAAGTAC
ATCCTCGAGAACGCGGTTCACGCGCTCGGTCTGGCCGTCGGTCTCCGGATGCGCCGCGGTCGACATCAGCAGACGAGTCCCAAGGAGCTCAAAGAGGCGG
CGCCAGAACGCCGCCACGAAGCGCGTGTCGCGGTCGGAGACGATGGACTCCGGCAGGCCGTGCAGACGGAACACAGTGTCGAGGAAGAGCGACGCGCACT
CCGCGGCGTCGACATGCGCAGACACTGGCACAAGATGCACCATCTTGCTGAATCGGTCGACGAAGACGAGGACACCCGTGCGTCCGCGGGCGTCAGCAGG
GAGGCCGAAGATGAAGTCCATGCT