Description :
From Genome Similarity Track
Location :
Scaffold_503:11- 23151
Transcript NameFunction/comments
g13394.t1hypothetical protein
g13395.t1hypothetical protein
g13396.t1XP_009846822.1 hypothetical protein H257_19374 [Aphanomyces astaci
g13397.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
g13398.t1hypothetical protein

Sequence
23140 bases(100 bases per row)
CAGATTAGTTCTCGTCAGCGACTTGAACCATCTGCAATCGTCGTTCGCTGCGCCGAGTCCGCAGATAATCGTAAAGTAGCCCCCCGCATGATAAATTTGA
GGCAGGCTCCCACGTGGGCTCATCATACCCAATCCACTTCACTTTGAACTCTCGGACAGCACGGCTAGTGCTCGTCGACAGCGGGGATCGGTCATCGAGG
ATGGTTTCTACCTCATATTCGCCAGCGAGCTGATCCGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAGTCCAATCTCGTATCCTCGGTCACTT
CAGGTGCTAACCGACTCTTCGGTCGGTCTACGAATTCGTTGACGGCCTTGAGTCGGGACACGTGCACCACCGGGTAGAACCTATACCCACTTCGGTCTGG
AAATTCCAACTCGTACGCAAACTCTTCGATCTTTTTCTTGATCCTGAATGGCCCATGCCATCGGTGGGCCAGTTTCTTGGTCAACCCTGGCTTGACTCGT
TCCATATACAACCAAACTCTGCTTCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGGTCAGACGTTGCCCCCGTCTCCACCTGTGACTCGTCAG
AAGTCTCGTTTTCATCGACATTCGGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGAGCTTTCTCGACACTTTGGTA
CTCCATTGCCATTTTCCACGAGATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGACGAC
GACATCGCTCGCAGCGTGGATTGTGCGTCCCATCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCA
ATCGCTCCGCGATCTCGTCCCAGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGGCCTCTCTTGCTGTCCGTT
CGCCTCCGGCCGATAGCTCAGGGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGT
CGGATCAGAGTTGGTGCTCCGAATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGA
ATCCTGTGAACGCGCACTGGAACAGTAATAGGGCTGAGTTGCCCCGACGAGACTTCGGTAAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTC
GCTCTGCTAAGACATTTCCTGGCGAATAGCCTCGGAACTGTGGTCGACTTTTCTCGAACTACAGTCGGGGCAGGACCTGACGTGTCGTTCGGCGTCTGCA
TATAGTCCAATCCAAAAATAGTCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTT
CCTGAATCATCGTTGTGGGCACCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTTCCCCACCGACGGTTCGTTCCAAGAAAATACAGTACACCATC
CTCGCTAAGCACGAACTTGTCGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTATTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGAC
CATCTCAGCTCTTCATCCTGGGCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTTGGAGCGCCAGGGTCCG
CCTCGTTGCTCGATTGCTCGGCTCTCAGCTCACTCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTGTACCATTCGGCCCTATCACCGA
CGTTTCATCTGCAAACTGGACTCGTTTCTTCCTCGCTTTTTCTTGGTGTCTGGTCGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAA
GATCTGTCGCGGGAGATTCCACGGGCTACTTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTTGTCTGTACTGAGGGTTCATAGATGACCT
CTTCGATCCGGTTCAGCTCGACCAATTCTAATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCCTGCCAACGAATCTGC
CGCAGCGTTGAACTCTCGGACCACGTGCAAATACTTCACTGACGCAGCTTGGTCGTGATCTCTCGGTGACGATTCAGTTGTACCATCAGCGACTCCTTTC
GACATGCCATCACCCCTAGGGACTGCTGGATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCTGAGACGCCGTT
GTTCATTCCAGCATACTCAGCGAGGTTTACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAACCCAC
GAGCAACTGCCGTATCCACCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGT
GGGGGTCCATACGAGCAGTGGGTGACCCTTTCGTCGGCGGTGTAACCGGGGCCAACGAGTCTTCCAATTCCACGAAGCTTGTGAGGCCAGCTTGGAGAAG
CTGAGCAAACGTGCAATCGCGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTG
GATTTGTGCACCCATTCGAGCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTA
AGACCTCCTTTTCGGCCGGGTGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCGCAAAATCGAACTGGGTGCAACTTGTCATCATGGTATTGCATCAA
AGTGGAGCTCAATGCCCACTCATTCGCGAATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTTTGTTGG
AGCGCCGCGAAGCTTCGTTTGGCCGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGATACAAAGCTGCTCCATACACTGCGAAGTCCT
GGATGAATCGACTGTAATAATTCAGCGCACCGAGGAAAGACTGCATCCCTTTTTTCGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGT
GTTGGCTCGAATACCTTCTGCAGAGACTTCGTGTGACAGGAAATCTACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCG
GTGAACCGTTGGAGCAGTCGGTCTAGCGTCTCCAGGCACGCGTCGAAAGTCTCGGTCCCAAAACAGATGTCATCGACAAACGACCGTCGGTCGAACACTG
GCACCAACGAGGATTCATCCGGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCATTCACTGCGTCAAGCGTGACCGAGGATTCGCG
GTCGGCCTCGAATTTGGTCGGCCGAGTTGTTGACTCCTCGGGTTGTCGCAGTGAAGGGTCGGTCACCCCTGTCCGTGCAACCTCGGCGTGGGTTTCGGCC
GTTCGCATAAGCTCCGAGAAGTGGGGCCAGCCGCCTTTGGGTTGGACGAAACCCCACAGAGCATTGTCGATCATTCGTTGGTAAATCATTGGTGCGTTCT
TTAATCCAAACGGCATACGAAGCCATTCGAAGTGTCCGAGCGCACAGACGAATGCCGAGACCTTGCGGGCCCGCATCGTCATCATAATGGCCCAGAATCC
ACTGGCCGCATCAAGCGAGCAGAACCATAAGTAGGCTTCCAAGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTAACTGCA
TTCACCAGCTTGTAGTCGATGCACAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGAGCGACGCCCATGGGCTGTCCGAAAACGCCACTA
GACGAGCTTTCAGCAAGCCTTTCAGAAGGTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGGGTGGATGCCCCTGTAC
GTCAATATCGCACACCACTCCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTTTCAGCACCACAACGAGACTTTCT
TGTTGACGGGCCGTCGCACTCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAAGTCGT
GTGCATAGTCCGTCAACTCAATCTCATTCGCCAAATGTTCGGACGTATTGGTATCGGTGTTCCCACTACCTGAACCGTCCCCCGTGGTAATCTCATGCAT
CATTGCTACGAAGGCAGAGTCCAATCGGGTCTCCGGGTCATCACCGAGGACTGGGATGGAGTTCTCTTCACTCGTATACGTGGTATCCGCGCCATCAGAG
GTGTCGGTCGCCACCGAGTCGTCATCTTCGTCGACCCATCTATCTCCAACGGGTTCGTCAGAGGGTTGCACCGAAGTCGTCAACGGCATTCGGTCTCGTT
CTGTCGGTTCCTCCGTGTTCCTGTTCGCGAACGTTATCTGGCCCTCGTCTAGACCTCCCAAGTCGTCGGATGGTCGAGGTAGGATGCCGCTAGGTGTCGG
ATAGTCTCGTCGTTCTACAGCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGACACTCCGCGTAC
GCCAGGACTTGCCACTCCTCATACTTAGCGGAGTTCAAACGAGTGTATCCATCTCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGTACCGATTCGT
GTCTCGCGCAGTGAGCAATCTTCGGTGACACGTTCGTTAGTCGCACCATTGTCGGCTGTCCCCGTCGAGACCTCGTTACAGTGGGCACCAGGTTTCCAAT
CCGGCGTGCCCACACGTCGTGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGCCCTGGGACCGACAAATCTTCGGTCGGG
CGTCCAGTCACTTGCATGCTGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGGCGCCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGA
ACAGATCCAACCGGACTCCAGCTGGAATCATGAAGTCTGTTCCCAAGACTACATCAACGCCTGCACTGTGATCCATAAGCCATAGCTCAAATTCGTACAC
GCGCTCCCAGCCTAGAGTGACTTTAACGAGTGGGTCTCCATCACCCCTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGGTCTGGAACTTCGCGCA
AGCGCAACCGTTTCGCATATGACGCGGAAATCACACTGACATTCGATCCAGTGTCCAGCAGAATCCTCGTTCGCGAGTCGTTTACAGCCCCATTGACGAG
GGCTCGCAATCGCTTCCTCCTGTCATAGCGCTGGGATGACCACCATCCCATTCTCTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATGGA
TGGTCGATTTTGGCCATGCTGAGGATCGAAGCATCGGTTAGCTCCACTCCGTCTCCGTCCACACGTCGTCCATTCACTTCACTCTCACCGAGGCTTACGC
CTCTCTCCTTTACATTTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTCCGCATCCAG
CGCAGGTTTGGCTAACTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCTTGCAATT
CCGGCGAGAGGTTCTTCTTCTCGACCTTTGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACTTCCCGGCATCATGAACCTGTTTGCACATCTT
GCATCGCTTAAAGCAGTAGTGAGCTGAATGGGTGAGTCCTCCGCAGGCGGCGCATGGACCATATTGGCGTCGACCATCGCGTCCGGTGGAGTTTCGGCGC
TGGTCATCTCGGTCATACGGCCGTTGGCCGTTACTTGCCCTCGAACGACAGTTGTCGGCGCGAGCGAACGTTCCCTCAGCCGCATTGCGACGTTCGTTGT
CGTTTGCAGCGGCCACGTGGCCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCGAGTACCCTTCGGAGTATCGGTCGTCATCGCCAGAATGAGACTCCGG
TCCGTACTCCTCGGTGTCATCATAACCGCCGTTGTGTGCTTCTGGGTATCCTCCACGCGTGTCTGCCGAGCGTCCCACATTCAGCGCCGTCACTATATTG
GTCAGTGCGTCAGTGAGAGTGACCCTCGGCCGATACTGTTGGTCATCCCGGCGACGGTTATCGTCTCGGTAACGGTCTTCTCGACGACGGTCGTCCTCTC
GGTGACGTCGGTCTCGGCGATAGCCGTCCCGCGGATCCTCGGAGCGTCCACCATCGCGTCGGCGTGCTACCTCTTGCCCTCGAGGGCGGCGGACCGAGGA
CTCGCGTCCAGGTTTTCGCTCTCTGCGATGAAGGATATCATTGATCATATCCTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGACGCTCTTCT
AGACCTCGGTCTTCGCACGAATCCAAGAAGTGCTCGACGTGGTCCTTTGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATAGCCGT
TAAGTCGGTTGAGGTAGTCGCAGACATGCTCCTTCTCCTCTCGCTTGGCCGAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCTCGAACAGTAGTACTT
AATGAACGCATCGCTCAACAATTTCCACGTGCGTCTCGTTTTGCGGGGTAGCTGTCGGTACCAATGCAGAGCACCATCTTGGAGGCTCAATTCAAACGCC
ATGCACCATTCGTTGGGCGGCGTGTGCGTCCCTTTCATCTCGTATATGAACGCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCCCAAGT
ACGGCTTGATGTTTCCGAGTGGGAGGTGCGTGGCGATCTCTAGCCTCGGTGTCGCACTGTCATTCTCCACCGCGCTCAACTCACGAATTTGGCGTGCCCA
TTCTCCCGTCAAGTCACCCCCGGTGTCTCCGACGTCGAACGAATCTTCGTCAGATGAGTCGTCGCGGAGGTCGTAACGTCGGCTGGGCGTCCGACTTGCG
CTTCGTCCAGCAGTCGGAGCGGTTCGATATCCCTCGGCCTCTCTCGCCAGTCGTTCTGTACGACTGACCGACCTTGGCGTCACCATGTGAGAGTCTTGGA
AATACGTCGACGTCGCACCTTGGGCAGAAAATATTCCGGCCTCGGTCGACCCTCTGGGGCGTCTTCCAGGGGTCGAGGGCAATGGAATCATGGACGGGTC
GACCGGATCCGATGCGTGGCGGACGTTCGGTGGACGGCTAACTCCCGCCTCGGCCACCCCGAAGGCCGACCGAAGCTTCTGCTTCCACTTGCGAAGCGCC
GTAGCGGCGTCCTCGGGTGCCCATGCTCGGAGGTCTGCTTCCGACGGGAACACGCGTAGGAGTTGCACCGTGTCCTCGGCCACCTGCCGAGTATTCCACG
ACTCCACGGGCACAGTTAACTCGCCACCGAGCTCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGATCGCACCCAGTTGCTCTTCACCTTCAT
GAGTTCTAGGTATCGACCCAGAACTCGGTTGGCGGCCGGGGTGTCTCCGTTAAGAGGAGGCCGGCCGCCATTCGGCCGAGAATTCGCATTCTCGGCCATC
GCCGACGATCGGTGATCGTCGGACTCATCTTCGTCGTAACCGTTGGCTGGTTCGGGACCAGCCACCTCGTTCAACTCTTCGGTGAGGTTTCGCGCAAGCG
ACCTCACCCCTCCGCTGCGTCCGACAGATACTGCAGCGGCTTCCGAAAGCTCGGGCATAGCTGCCTTCTCTTCCAAGTCATCTTCTTCGTCATCTTCCTT
GGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACGCTCGTTGATCGACGCCAACGTACTCGGCGTCGCGAACGACGAACCGGAACGCCCCGAA
CCCTCTCTACGCGTTCCACTTGACCTCGCCGGCGTTGCTGGTACCGCTGACTTCGCTTCTTTCGCCATCTTCTTTCTTCTTCTTTTCTTTCTTCTCTCGA
ATGCTCGTTAAGGTAAGAACCTATATGCAACCAAGACACACAGAAGGTCACACCAATCCCGGGTCGCGGCACCAGTTGTCGTGTAGGAACACGCAGAAAA
TCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCTTCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCAGGAACGATCCCT
TACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGTTGAGTTCGGTCAACCTTAAAACCTGCACTACTAGCCACGAGCGAGGGCTATAATGCAATAT
TGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTAAGGGTACCGGCAGTCACGCCTAATACGGGTTTGCCGAGGGTAACCTCGGCGGGTAGTGAAAT
ACACTTGGGAACACTCGGGTTCCACCAATATATAGGGACCGACACTCCTTGTCGCCCCTAATTCTCGGCCACTCCTATCTCTTGGACTGACCAGCAACAA
ACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGACCCTAAGACAAGCTAGCTAGACTTACCGAAGACGGAC
TTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTATCCTACAGCTCTGGGAGCCTCTGTAGGTCATCATTTGGCTAGTCCTATATCTC
TATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGCTCTACACAGCCGAGGGTACGACACGAAATGGGTACAAACGAGGCTTTTA
ACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGTCACTATTGTTCCTAGGTCACTGTAGCGCGGGAAATGAGACCCGCCAATCAAGACGCTCT
GTCGCCGTTCACTGAAAGGTGCAACGTCAGCCAAACCGTGACAGTTCGGCACCAAAACCCAACGCCACACTGACTTTGCTGATCTAACTTGGCCCCGACC
GTGGGAAGGGAGACAACAGCACAGGCCATGGCAGAATCTTGCAGGGCTGAGTGGAGGGGGCAGGCCATTCTCTTCGGAGAAGAGGAAGCCCCCTTCTACT
GCCGCACGCGTTCGAGCAAGAAAGAGGGCCCGCCGTGTTGTCAAGGCGAGAATTATGGCGACCAGCACAAGCAGCGAGGGCGCGGCGGCCAGCACGAGCA
GCAGAGCAGTGGTGGACCGCACGAGTAGCACGGCTGTGGTGGCTATCCTTGAAGGGCGTTCTGGGGCCACCGAACAGTCTACCGAATGGGTATGCATGAC
TTGCACTCACACTAACGACTCGGACGCTAACGAGTGCTCCAACTGCAAGTGCAAGCAACCTGTCCCTACCGTTCCTCATACGTTCCTGTACCGAACGGCT
GGCTAGTGTACTGACCGACAGACTGTGTACCAACCAGGCACTGGTGCTACAGACGACTTGTTCTTCCGCATGTACAATGAATATTACGGACCAAGTCGAG
TCACTGTTGGCAAGTCTTACACGTCCACTAAGCAGAAGTGGCATGTAGCGCGTATTGTTGAAACAGGCAAATGTCCTCGCTCGGATTCGAGTACCGCGTT
CTGTGGCTTGTCCGACGGCGTCTTGGTAGGCGCTACTGCCTGCGGGCATAGAAGCCGCAAGAGCACTCGCAGCTGATGGCTTCACAGAGGAGGCCGCTCT
TGTGGACCGCTGGAAGAGTTCAAACGTCAGCAATTTCGACGAGTTCTGCAAGGAGGATAAGTTTGGATAGCACTTAATTGCTGCGAACATGGAGGGCCTC
TGCCTATTTAATGCGTTCAAGATCATCGCCGACTCGCTGGTCGGCCTGATATTGTGAGCAGAGCAGGCATTGATGGTTTCGTTGCCGAAGAGAAAGACCG
GTTCGGCATCGACCTTACGCAAGGAACGTCGTGGAAGGTTTTTCTTGTGTTCCTGCGCCGCCTACAAGATGATGGTCGCGATTTCTACTTCAAGGTCATC
GCGCAGCGTAATTTCGCAATTGCAGGACGTCGAGGAGCTCGTGTTCTTGAAGAAGTGGAGCTGGACGACGGATTGTATTTGTGTGCAGGATACAATCACT
CACTCGCTGGCCACGCGTTCGTTCTTCGAGTTCTAGAAGAACAGCGTCTCGTGTTCGATCAAGGCCAAGTCATGCTTCCGCAGGCAGTGGAGTGGATTGA
TTTCGTCGATTTCGTTCGTCCTTTCGCTTTTACTTAGGAGTAGATAAGAGGAATCGGTAGGGATTTCCGCGAGTTTACCTTATCGATAATGAACTTTTCC
AGCAATTTATTGCCATAAAAAATAAATTTTCATGTGCCTATTGTAATTCGGTACTAGACCAGGGAAACCTCTGTGAGGGGAAAACCTTTACTGCGAACAA
AATAAAGAAAACCCAGTGAAAAAAATAAAAGAACGCATTTTGAGTGGACACGCTTCATGCATTAGTGTTACACTCGTACACTACAACATAGTGACCTGTT
GATGCTTTCAGGGATTTCGTCCTGAGCTTGGTCCTTAGTTCTCTGAACTTATGCTTATCTAATGCTTTAGTAAATATGTCAGCAACCATATCTTTCGTAT
TGCAATATACAACGGAAAACTCTTGTCGCTCAACTTTTTTTTGCACAAAATAGTATCTTACGTGACTGTGCTTTGACGTCCCGTGCAGTTCGGGGATATA
CCAAATCATAATGCAGCTTTGGTTGTCCTCATGAATGAGGTTGGCGTGCGTGGCAGCAAAGCCTAACTCTCTTAGAAATAGTTTGAGGAATATCATCTCT
CGCATACAATGCCACATGGCGATATATTCTGCCTCTGTTGTTTATAGGACAACGGTGTGATGTTTGCGCGAAAGTCATGAGGCTGGACTGTTAGCTAACA
TAGTCACATAACCTGTGACGGAGTGTCTCGTGTCAGGGCAGTTGTCATAGTCAGAATCACTGAATGCGGCCAGGCTGTTTGCTAGGTTCTCTGGTGTGAT
GTCTTTCGACTCACCCAGGCAAATACCATATTATTTGGTATCCGAAAGGTACTTTAGCCTTCTGACAACTGCAATTCAGTGTCCCATTCTTGGTTTAGCT
AGCAATTGACTATGTAGAACGCCATGTCAGGTCTAGTACCTACCATGAGGTAGAGTTCAAACGTCAGCAATTTCGACGAGTTCTGCAAGGAGGATAAGTT
TGGATAGCACTTAATTGCTGCGAACATGGAGGGCCTCTGCCTATTTAATGCGTTCAAGATCATCGCCGACTCGCTGGTCGGCCTGATATTGTGAGCAGAG
CAGGCATTGATGGTTTCGTTGCCGAAGAGAAAGACCGGTTCGGCATCGACCTTACGCAAGGAACGTCGTGGAAGGTTTTTCTTGTGTTCCTGCGCCGCCT
ACAAGATGATGGTCGCGATTTCTACTTCAAGGTCATCGCGCAGCGTAATTTCGCAATTGCAGGACGTCGAGGAGCTCGTGTTCTTGAAGAAGTGGAGCTG
GACGACGGATTGTATTTGTGTGCAGGATACAATCACTCACTCGCTGGCCACGCGTTCGTTCTTCGAGTTCTAGAAGAACAGCGTCTCGTGTTCGATCAAG
GCCAAGTCATGCTTCCGCAGGCAGTGGAGTGGATTGATTTCGTCGATTTCGTTCGTCCTTTCGCTTTTACTTAGGAGTAGATAAGAGGAATCGGTAGGGA
TTTCCGCGAGTTTACCTTATCGATAATGAACTTTTCCAGCAATTTATTGCCATAAAAAATAAATTTTCATGTGCCTATTGTAATTCGGTACTAGACCAGG
GAAACCTCTGTGAGGGGAAAACCTTTACTGCGAACAAAATAAAGAAAACCCAGTGAAAAAAATAAAAGAACGCATTTTGAGTGGACACGCTTCATGCATT
AGTGTTACACTCGTACACTACAACATAGTGACCTGTTGATGCTTTCAGGGATTTCGTCCTGAGCTTGGTCCTTAGTTCTCTGAACTTATGCTTATCTAAT
GCTTTAGTAAATATGTCAGCAACCATATCTTTCGTATTGCAATATACAACGGAAAACTCTTGTCGCTCAACTTTTTTTTGCACAAAATAGTATCTTACGT
GACTGTGCTTTGACGTCCCGTGCAGTTCGGGGATATAGCAAATCATAATGCAGCTTTGGTTGTCCTCATGAATGAGGTTGGCGTGCGTGGCAGCAAAGCC
TAACTCTCTTAGAAATAGTTTGAGGAATATCATCTCTCGCATACAATGCCACATGGCGATATATTCTGCCTCTGTTGTTTATAGGACAACGGTGTGATGT
TTGCGCGAAAGTCATGAGGCTGGACTGTTAGCTAACATAGTCACATAACCTGTGACGGAGTGTCTCGTGTCAGGGCAGTTGTCATAGTCAGAATCACTGA
ATGCGGCCAGGCTGTTTGCTAGGTTCTCTGGTGTGATGTCTTTCGACTCACCCAGGCAAATACCATATTATTTGGTATCCGAAAGGTACTTTAGCCTTCT
GACAACTGCAATTCAGTGTCCCATTCTTGGTTTAGCTAGCAATTGACTATGTAGAACGCCATGTCAGGTCTAGTACCTACCATGAGGTAGAGTTCAAACG
TCAGCAATTTCGACGAGTTCTGCAAGGAGGATAAGTTTGGATAGCACTTAATTGCTGCGAACATGGAGGGCCTCTGCCTATTTAATGCGTTCAAGATCAT
CGCCGACTCGCTGGTCGGCCTGATATTGTGAGCAGAGCAGGCATTGATGGTTTCGTTGCCGAAGAGAAAGACCGGTTCAGCATCGACCTTACGCAAGGAA
CGTCGTGGAAGGTTTTTCTTGTGTTCCTGCGCCGCCTACAAGATGATGGTCGCGATTTCTACTTCAAGGTCATCGCGCAGCGTAATTTCGCAATTGCAGG
ACGTCGAGGAGCTCGTGTTCTTGAAGAAGTGGAGCTGGACGACGGATTGTATTTGTGTGCAGGATACAATCACTCACTCGCTGGCCACGCGTTCGTTCTT
CGAGTTCTAGAAGAACAGCGTCTCGTGTTCGATCAAGGCCAAGTCATGCTTCCGCAGGCAGTGGAGTGGATTGATTTCGTCGATTTCGTTCGTCCTTTCG
CTTTTACTTAGGAGTAGATAAGAGGAATCGGTAGGGATTTCCGCGAGTTTACCTTATCGATAATGAACTTTTCCAGCAATTTATTGCCATAAAAAATAAA
TTTTCATGTGCCTATTGTAATTCGGTACTAGACCAGGGAAACCTCTGTGAGGGGAAAACCTTTACTGCGAACAAAATAAAGAAAACCCAGTGAAAAAAAT
AAAAGAACGCATTTTGAGTGGACACGCTTCATGCATTAGTGTTACACTCGTACACTACAACATAGTGACCTGTTGATGCTTTCAGGGATTTCGTCCTGAG
CTTGGTCCTTAGTTCTCTGAACTTATGCTTATCTAATGCTTTAGTAAATATGTCAGCAACCATATCTTTCGTATTGCAATATACAACGGAAAACTCTTGT
CGCTCAACTTTTTTTTGCACAAAATAGTATCTTACGTGACTGTGCTTTGACGTCCCGTGCAGTTCGGGGATATAGCAAATCATAATGCAGCTTTGGTTGT
CCTCATGAATGAGGTTGGCGTGCGTGGCAGCAAAGCCTAACTCTCTTAGAAATAGTTTGAGGAATATCATCTCTCGCATACAATGCCACATGGCGATATA
TTCTGCCTCTGTTGTTTATAGGACAACGGTGTGATGTTTGCGCGAAAGTCATGAGGCTGGACTGTTAGCTAACATAGTCACATAACCTGTGACGGAGTGT
CTCGTGTCAGGGCAGTTGTCATAGTCAGAATCACTGAATGCGGCCAGGCTGTTTGCTAGGTTCTCTGGTGTGATGTCTTTCGACTCACCCAGGCAAATAC
CATATTATTTGGTATCCGAAAGGTACTTTAGCCTTCTGACAACTGCAATTCAGTGTCCCATTCTTGGTTTAGCTAGCAATTGACTATGTAGAACGCCATG
TCAGGTCTAGTACCTACCATGAGGTAGAGTTCAAACGTCAGCAATTTCGACGAGTTCTGCAAGGAGGATAAGTTTGGATAGCACTTAATTGCTGCGAACA
TGGAGGGCCTCTGCCTATTTAATGCGTTCAAGATCATCGCCGACTCGCTGGTCGGCCTGATATTGTGAGCAGAGCAGGCATTGATGGTTTCGTTGCCGAA
GAGAAAGACCGGTTCGGCATCGACCTTACGCAAGGAACGTCGTGGAAGGTTTTTCTTGTGTTCCTGCGCCGCCTACAAGATGATGGTCGCGATTTCTACT
TCAAGGTCATCGCGCAGCGTAATTTCGCAATTGCAGGACGTCGAGGAGCTCGTGTTCTTGAAGAAGTGGAGCTGGACGACGGATTGTATTTGTGTGCAGG
ATACAATCACTCACTCGCTGGCCACGCGTTCGTTCTTCGAGTTCTAGAAGAACAGCGTCTCGTGTTCGATCAAGGCCAAGTCATGCTTCCGCAGGCAGTG
GAGTGGATTGATTTCGTCGATTTCGTTCGTCCTTTCGCTTTTACTTAGGAGTAGATAAGAGGAATCGGTAGGGATTTCCGCGAGTTTACCTTATCGATAA
TGAACTTTTCCAGCAATTTATTGCCATAAAAAATAAATTTTCATGTGCCTATTGTAATTCGGTACTAGACCAGGGAAACCTCTGTGAGGGGAAAACCTTT
ACTGCGAACAAAATAAAGAAAACCCAGTGAAAAAAATAAAAGAACGCATTTTGAGTGGACACGCTTCATGCATTAGTGTTACACTCGTACACTACAACAT
AGTGACCTGTTGATGCTTTCAGGGATTTCGTCCTGAGCTTGGTCCTTAGTTCTCTGAACTTATGCTTATCTAATGCTTTAGTAAATATGTCAGCAACCAT
ATCTTTCGTATTGCAATATACAACGGAAAACTCTTGTCGCTCAACTTTTTTTTGCACAAAATAGTATCTTACGTGACTGTGCTTTGACGTCCCGTGCAGT
TCGGGGATATAGCAAATCATAATGCAGCTTTGGTTGTCCTCATGAATGAGGTTGGCGTGCGTGGCAGCAAAGCCTAACTCTCTTAGAAATAGTTTGAGGA
ATATCATCTCTCGCATACAATGCCACATGGCGATATATTCTGCCTCTGTTGTTTATAGGACAACGGTGTGATGTTTGCGCGAAAGTCATGAGGCTGGACT
GTTAGCTAACATAGTCACATAACCTGTGACGGAGTGTCTCGTGTCAGGGCAGTTGTCATAGTCAGAATCACTGAATGCGGCCAGGCTGTTTGCTAGGTTC
TCTGGTGTGATGTCTTTCGACTCACCCAGGCAAATACCATATTATTTGGTATCCGAAAGGTACTTTAGCCTTCTGACAACTGCAATTCAGTGTCCCATTC
TTGGTTTAGCTAGCAATTGACTATGTAGAACGCCATGTCAGGTCTAGTACCTACCATGAGGTACATTACACTGCCAATGGCTTCGCGATACGGAAATTCC
TTCATCGCATCTGTCTCTGCTTTACTAGCAGGTTGGCTACTCACGGAGAGTTTGACGTTCTATTCTACTGGGGTTGCAATCGGATACGGAACGTAGTCGC
TGAAACGGTCAATGAACTTCGTAGCGTACTTGTGTTGGTGGACAGATATCGTTCGGCTCTTACGGTCACGTTGAATAGACCAGCCGAGTGAGTACTTCAT
CTCCCCTAAATCTGCCATGCAGAAACTCTTCTTAAGGGCTGATTTTAGCTCACAGACGAGGACTGGTGTTGGTGCAATGATCAAAAAGTCATCAACGTAC
ACCGCAATATAGTAGGTGAAGTGCGTAGGAATACACAACTGTCCTTAACCCCCTGGTTCCCAGGAAAATGTACCCATAACGGCGAATTGAATGTCGTATC
TTACGACGTAGCGGCTCTCTTGAAGTCTGTATTGGTGCAAGTGACTACTTGCGGGTAGGTGTATAAATTGTTGAGAGGTTTTTCAGTGGATGTCTGATGG
AAGGTATGGATCTTGGACACCGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAAC
GAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATATACACTACTTGATTCTTTACTGGATACTGA
GTTACTTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATATTGTACCCACAGGTGGCGTAATCGACAGTGGCGTAATCGTCGGTG
GCGTAATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAACCGGTAACCCTCCATACCCTCAATACGCCC
CCTCAATGCGAAGTCCCATGAATGCCGAGAGCCGCCGTCAGCTCCGTGTGGCGTGGTCCCGCAAGCGCCTTGGTCATGATGTCCGCCAGCATCACAGAAG
TCTCGCAATACTCGAGCTTCACTTCACCGCGTTTCACTTCGTCGCGGATGTGGTGGTACTTGATGTCGATGTGCTTGGCGCGGCCGTGGTTCACCGGGTT
CTTGGTCATCTTGATGCACGACTGGTTGTCTTCACGGATCATGAGCTCGGGTCCCGTTTCGTTGGCAGCCGCCAGAATCTCGCACAGCAGGCGATGGATC
CACTTGCCCTCTTGGATAGCCAGACTGAGCGCGATGTACTCCGCTTCGCTCGTGGACAGCGACACACTTGACTGCTTCTTGCTTCCCCAGCTCACAGGCG
CACTCATGAGCATGAACGTGTAGCCTGAAGTGGACTTGCGGTCCGCGAGGTCGCCGGCCCAGTCCGCGTCCGAGTAGCCACGAAAGTCGATCTTGTCGCC
CAGCTTGAAGCAGATGCCATGCGTCTTGGTGCCTTGCAGGTAGCGAAAGATGCGCTTGACCGCAACCCAGTGTTCCTCTTGGGGGTTCTCCATGAAGCGC
GACACATAGCCAACGGCGTACGCGATGTCCGGGCGCGTGGCGGTCATCAGGTGCATCAGCGCACCAACCGCTTCGCGAAACGGAGCGTTCACCTTGGTCG
CCGCGTCGCTTGGAACCAGTCGAGTGCTCATGTCCACCGGACTCACCACGAGCCTTGCACTCGTCCATGGCGAAGCGCTTCAGGATGTCGTCCACGTAGC
GACGCTGGCACATGGTCACGCTGCCGTCCGGGCCGTCCACCAGCTCGATCCCAAGAACAAACGCGCACTTGCCGCTGTCGGTCATCTCGAAGCGCGTCTT
CAGGTCCGTCTTCGTGCGCGAGATCAGCTCGGGCGAACTCCCGGTAATCAGCACGTCGTCCACGTACACCAGCACGAGCACGCAGTGACCGTCCACCACT
TTGATGTACAGGAACGGATCGAAGGCCGACACTTGGAAGCCGATAGAGCACATGAACTCGTCGAACGTCTCGTTCCACACGCGCGAAGCTTGCTTGAGAC
CGTAGATGGCCTTCACCAATTTCAGGCAGTCGAAGTTACCATCCAGTTCGACGCCTTCGGGAACCACGCAGAACACCACCTCCTTCATGACCCCGTACAG
GAACGCTGTCACGACGTCGAGTTGGTCGAGGGACCAGCCGAAGTACTTGGCGATCGCGATGATCATGCGCAGCGTCACGTACTTGATCACGGGCGAGAAC
GTCTCCGTGTAGTCGATGCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGGCGCGCCTTGTACTTCTCGATCGAGCCGTCCGCTTTGCGCTTGATCTTGA
ACACCCACTTGGTGCCGATGGCGCGCTGGCCACTGGGCAACTTGGCAGCTCGAAACACACCACGCAGTCGCATCGACTTGAGCTCCGCGCGGATCGCCTT
GCGCCAGTGCACTTGATCCGGACCGTTCACAGCCTCTTGGAACGTCGTCGGCTCCGATAGATCGGCTGCTGCTTCCACAGCGTTGGCACTGGCACGCCAA
AACACTGGAGGCGTCGAGTCGTCGTCTTCATCTTGGTCCCCAGACTTTCTTCTTCGTCGGGTTCAGCTCGGCGCGAGGAGGATACGTCCGGCGCACTTGC
TTCTTCTAAGGCAGCTCGGTGGCGAACGGGGCGCGATCTTCTGGCAGTGTCGTCGTCGCCACTCGGTCGGCCCTTGCGCTTCCCCGCCTGCTTGAAGTTC
ACTTGGCGCGGTTCATCGTTGTCGTCCAGGTCCAGCGCGTCCAGGTCCAGCGCAGCATCATCGACGTCTTCATCCGAAGTATGCGCCGAAAGTCTAAAGA
CCGACTCATCGAAGTTGACATCGCGACTGACAACCACCTGCCCCGCCTCGATGTCATAAAGTCGATACGCCTTGGACACTTCTTCGTAGCCGAGGAACAA
CCTGGCGCGAGCCTTGGGGTCCCATTTGCGCCGCTTTTCCTTCGGTGTCAGGATGTACGTCTGGCATCCAAACACACGCATGTGTTTCACACTTGGCTTG
GACTTGTACACAATCTCGAATGGAGTCTTGTGCTCCACCTTGGGTGACGGCAGGCGGTTCTTCACGTAGATGGCCGTCATGGCCGCCTCAGCCCAGAAAC
ACTTGTCCAACTTGGCGTGATGCAGCATGCTGCGGCCGATCGTGACGATGGTCCGGATGGCGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAAC
CGTGGTTTGCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGTTGGTCGCGAACTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAG
TGCAACATGCACTAAGGGATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCA
ATGAGAGTCATTCAATAGATAGGGGTTCTGCCATCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAAT
ACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTCAGTATACTTGCGGATACAAGTATACTAAACTTAAGTAAATTACTCCTA
CGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACT
AACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCG
TGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTA
TCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCG
TGGAGTCACTGAAACTCCACGTAAGCAGCTACGTTGGAGGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGGCTCGACG
TATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGACCCTACGTGC
TTTAGCACGTACGAGGATTTCAAGGAGGAGCTCAAACAAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGG
GCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCAT
GAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTCGCAATGCAAGAAGAGTTTAGC
CTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGA
CAGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTGCA
CGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAGAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATC
GAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCC
TGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTT
CGAGGAGGTGAAAACACCTCGAAGTCTATTGGAAGTGAGACTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCATATCGTACGCGTACGCTTCTCGTAT
CAAGAGAAGGAGTTCGTCGACGAGCTTATCGTTCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGA
TCGACTGGATGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATG
CGGCCCTCCATCAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCGAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGAAGATGTGAAACGAAT
CAGCAGGGCCTGATTCAATCGGATTCGAGAGGGACTCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACAGATAATGCCGACACACAATTTGTCGAAAGAC
ACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCATCGGAAATGCT
TGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGATGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAG
GAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTC
GGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAGTGTCTTGACGCGTACGAGTATTGG
TCTCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTG
CACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACG
CCCTCAGCGCGAAGTCGAAGAAGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTA
CTCCCGGACGATATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGC
CACTGACGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGAACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTAC
GTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATACGACGGTACCGGCACAGACGCCGATACCTCGAAAA
GATGTGATCATCGATTCGATGACCTCGAGTACTATCTTAAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATTCCTC
TCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCCGCAGGGACTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCA
CTTGTTGCGCTCGGTGCGCAGCTTCGCACCGAGCTATTTCGATGATGTATTCATTCACATCCGGGCTGGTCGGATGTGGAGTTGCATACAGAGCACCTCC
GCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTATGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGG
GAAGAACGGCGTACACCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGACCTGCGGCAGTTCCTTGGACTCGCC
ACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGGTTGTC
AGCAGGCCTTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGATGCATCCGA
TTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAA