Description :
From Genome Similarity Track
Location :
Scaffold_385:11- 2247
Transcript NameFunction/comments
g17384.t1hypothetical protein

Sequence
2236 bases(100 bases per row)
TCTAAGTCAACCGTTCCCCAAGACCGGGAACTAGTGAACCGTCGTTCACTTGGAGTTTGTGTACTCCTAGCACTTCCTCGAGCGCAAGGTGCTGTGTGAC
TCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAAGATTGGACTACCTGAATCCTCTGTGGTCTCAAGCATTGAGCCACCATGGA
TCGCAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCAGGCATCTTCGGGATGGATGCCCTCCAGAGCTTGGCGGCAGCA
ACACCTGCCGAGCAGCTCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGCTAATCGCCCATGTACGTGGGAGCCTACAGGCCCCTGTGGCTGAAC
GAAAACCAGTTCAGCCCAAGCCTTTGAGGCTGAAGGTTAACCCCTACGAAGGGAAGGAAGGGGAAAACCTTCACTTCTGGGTCCGAGAGGTTTAGCTCGC
TATGGACGCGGCTCTCGTCTCGGATGAGCGACTCCGCGTCGCTTTTGCTCTCTCCCACCTTAGTGGTCGAGCAAAGAGCTGGGCGTATACGCGTGAAGCG
ACAACGCCTGGATGTTTTGCATCCTGGGCTCAGCTGTGTGAACAGCTTCGAGCCGCCTTCCTCCCGGCGAACTATGAGTATCGCCAGCGCTCACGCTTCC
TTGCGTGCAAGCAAGGGAGACGTGAGCTGCACGAGTACATCCAGGAGATGCGGGAGCTCACCGCATCTCTGGTGGGAAACCCACTCCATGAACACATCAA
GGTGACGGTGTTCATGGACGGCCTGCGAGTAGGCCCAGCACGCACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAAGAAGCGATTCAAATCGCTCTT
CAGGAGGAGTACAGCCATCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGGCTCCACTCAGGGCGGGCCCCAAAGTAGAGGCCCCTTCAACGGTC
CTGTGCCGATGGACCTGAGCCTTGCCGAACAGCACGACATTCGCTGTTTCGGCTGTGGCAAACTGGGGCACATGAAACGTGCGTGCCCCGCGGGAGGAAC
AACACGGCGGTTTCCTCCCAAGCCCTTTGGTCCTAGGGGTCGCTGGCAAAAGCCGCGACCCCGTGGCCAGGGGAACGCAGGGAACCAGTAGGGGCGGGGC
GCCCTACTGGGGAAGATCTAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGAAGGCTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAA
GGGCAGAGGAGGGCTGCTTGTAGTACATGCAAATGTACGGGGATACGATCATCCCATGAGAATCTTGATCGATTCTGGGGCGTCAAAGAACTTTGCACGC
CGCCGGACGGTCGCTCGCAAGAGCGACCAGTTCACCGATGCTTTACGAGAAAGTAAAGGGAACGGGCATGTCCTAGTCAGACTGGCTGACGGGACTGTAG
TGGAGGTGCCCAAGGTCTTTATGGACCTGTCCGTCAAGTTTGAGGACTTTAATTCCACTGAACGATTCCTCGTTCTTGATATGGACAAGTACGACTTGAT
CCTGGGCATGCCATGGCTTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCATCGGGGCTAGCCGGCCTGCTGCTACTGACAGAGCATTGGTG
AGTCATGTTCCCACCTCTGTCAGCAACCGGGCCTACCCCCGGAGCCGAGTCGGAAATGACTCCGAAGAATTAGTTGCGGCAGGAGCCGCAACAGGTGTCA
TGACACCGTCCACCGCGGGCAACGGACCGCCACAGGCAATGCCGGTGGACAGGACGTCGAGTCCAGCGAGGGGAACTGCAATGACAGCAGTACCCACCGC
TCCTGACTATGGCACCGTACGGCCTTCGGCCTTATCGACGCCGGGGAAAGTCAACTCCCCAAGGGCAACGAGCCCACGTGAGACCAAGGAGGTCGAGACC
GTGGCCAGGGTCGAGGTTGCTGGGAGCACCTCTGGTGTGGGTAACAATGTGCCACACGGAGTCGATGGAACTCCCGACTCCACCCTTGAGTCACCACCGG
CTGTGGGTAACAAAGGACCATGCCGTGGTGGGCATCGACGACGTCGTCGCCGCCGTAAGCCGAGTCTGGTGAGACAGACTGGAGTCGCTACAAGCGACTC
GGAGAGAGAGAACTCTCCTCAGGCACGGCCGGCCGA