Description :
From Genome Similarity Track
Location :
Scaffold_2951:11- 2150
Sequence
2139 bases(100 bases per row)
TCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGAGATCGACGGGTTGA
GATCCAAGCAATGGAGGTTGGATCCACGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGACGAAGGATTGCAGAGGGCTAAA
GCCGAACAGCCGGATCCCGCCGATCCACAAGTGGATCCAAGCTTTCCACTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACGCTAGTCCAACCTG
AAACGGTCGGGTTTTATAAATCTCTCTCTAAAGAGAAACCGCGTGGATCCTCAAGAGTGAATTCCCCCCGTTACCAGAAAATCGCAACCCCAGCAAGACA
GAAGGGAAGTAAGCGTCGCAAAGAAGGTCCGCGTGCCTGGAATCCAAGGGTGGAATCGAACAAGAACCGAAGATGAAACAAGTCGCTACCCTGAAAGGCG
GGGAATCTACACGCCGAGGAATCGGGAGAAGTATGTGCGTAAATCCGGGAGTATCACTGACCACGAGGAGTCACGATTGATGATATCCAAGTGGATCCAG
GGGCGAACGAACCCACTGAAGTGGATCGTCTGCGTCAGAAGATCTGGGAAAGCCGACATCTGCTGATCGGTAAGGGTAATGCGTTACCGCCCGCCGCCCA
CGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAAACTGTCGGGATCTGA
TTAAGGGCCTGCTGCAAGCCAGGATCATCAGCTTCTCAACGTCCCCGTGGGCGTCGCCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTC
TGTGCATTGATTACCGGCTGGTTAACAGCCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGCTGAAAGATTTGGATAAAGTACTCTG
GTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTTTGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCTGTTCGAG
TGGAACCGGATGCCGTTTGGATCGAAGAACGCACCCCAGATCTACCAACGCCTCATCGATAACGCCCTCTATGGGTTCACCCGAATACCGGAGCCCGAAA
CGGGTGGATCCGGGGAAGGTGACGCAGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGGACCCCGTCTGTGTTAGGACGCAGATCTTACAT
CGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCGAGAGAGTGACGTCCTTACTGGTGGCGTGTACTAAGTGGAATCTCTCTATTAGTGTG
GTAAAGAGCTATCGGGGGATGCGCAAGGTGGAGTACTTGGGCCATCGAGTTTCCAGGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCG
ATTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCTTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGT
ATTGTACGAATTGAGAGAGGTAGATTTTGCCGCGATGACCACTCCAGCTGTCCAGATGAAAATCCAACAAGCTCTGGCCCAGGAGATGCCGGATCCACGA
AGGGATCCAAGTGGTAGGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAACAGAGAGAGGGTCTAGGCTGGATAGAGACGACGG
ATCAGAACATGGAAGAGGCAGAATCTCGGTGGATCCGAGAACAACACGCATTCGTGGAACTGAGGAACAGAATCGCGACCACGCCTATTCTCCGTCATTT
CGATCCGGAACGTCGACCTACGGTGATAGTTTATGCCAGTGACTGGGCAATCTCAGCAGCTCTGGTACAAGAACATGTGGGGATATGTCATCCAGTCACC
TTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGC
TAGTGGGAAGATCCATCCGGATCCTCACTCGACACTCTA