Description :
From Genome Similarity Track
Location :
Scaffold_2623:11- 1764
Transcript NameFunction/comments
Phyta_totarag14683hypothetical protein

Sequence
1753 bases(100 bases per row)
TTCTGGTGGCCCCACATGTACAAATGGGTTCGGAACTACGTACAGACGTGCGAGACGTGACAGCGTGTGAAGCCAGCTCCCTCGATGTCAGCCCCGCTGA
TGAGCCTGCCGGTGCCGGCCGATTGCTGGCGCTCCGTGAGAATGGACTTCATGTTCGAGCTACCGCCCGACGGGCGCGGCCACACTGGCATTCTGGTCTT
CGTTTGCCGCctcagcaagatggtgcGGCTTGCCTCGGTCAAGAAGAGTGTGTCGGCGCCGCAAGCGGCTCAGCTCTTTGTCGACAATGTCTTCCGTCAC
CATGGCCTCCCCGAGGCATTTGTAAGCGATCGAGACCCTCGGTTCGTGTCGTACTTGTGGCAACACCTCTTCCACCTGTTAGGCACTCGCCTCGACATTT
CCACGGCGGACCACCCATAGACCGATGGTCAAACGGAGCGGGTGGGCCGCGTGTTGGAAGACGTGCTGCGGAGCGTCTGCGCGGCAGAACCAACGAAGTG
GAGTGTACTTCTTCCCCAAGTAGAGTTCACCCTGAACAATGATGTGCATTCGTCAACGGGTTTCACCCCATTCTACGTGAATGGGCTGCGAAATCCTCGT
ACGCCTCTGGCGCTGCCACCAGCCTCTGATTTGGGTGAGGGAGAGGCTATCGCCGGGGACCCAAGGGGTCTCAAAGGTGTGCGTGCTTCCACCCAGCGGA
ACCTTCTCACGTTTATCGAGGAGGGCGAGGCGATCCGCCGGCGCGTCCGGGACGCTatggcagcagcgcaagacATACAAAAGGAGAACAGTGACCGCCA
TGGGCGGAAGAACACACAAGTGTTTAGTCTGGGAGACTTGGTTTTATTGAATGCGAAGAACCTACCTACACACGCAGTGTCCGCGGTGGGGAGCACGAAG
CTCAGGCCTCGCTTTGTGGGCCCATTCGCGGTCATGGGGGAACACGGCAACGCGTACACAATGGACTTGCCATCAGCAATGGCGACACACCCGACGTTCT
ACGTCGGCTTGCTCAAAGCCTATCGCTCGCCGGAGGAGTCTGACTTGCCGGATCCGGGTGACCCGCCGCATATTGACGCAGAGCGTCCCGCATCAccctc
tgcagcaggttgtgCAATCCCGGTCGCCAAGGCAGGGGCCGTCTgaggcgctggcgcagcCACCAACGCCGGCCTCGAGTGGGACTGCTGTTCCAGCCGG
GCCACGCGGTCGTACAACGACCGTAGCTAACCACGGTGGTCGCTTAGGTCATCTCCGACGCTCTGCGCGAACTGCTCCACACGCGCGAAGCGGTCGTCGA
TCCGACTCTGCTCCCTCTCAAGGTGACCCAATCGGTCCCGAAAGATCTTCGCCTCGTGCTTGTGCGTCTCTCGCGCATGGCGCTGATCCGTATCGGCCCG
GgactcaaggagctgcaagcgACCACGCATCGCGAGGAGGTCCGACCGCTGAGACTCGCGCAACGTCTGAcagctctccatcgcctcATGGAGGCCGCTC
GATCCCACAGCGGTTCGCGGCGGAcccgtcgacaacgaagacgTCTGACGCGCGGCGTCACGAACACGAGACCGATCGCCCGCGACGTCCTCCGCCCCCG
TTGTTGGATACAGATGGCGCCCCGCACTTCCACGTGGAgagcctgctgcagcaccgaggGCACGCCGGGCACTACCAGCATCTGGTGAAGTGGCGCGGCT
ACCCGAAGGATCAAAGCACGTGGGAGCCTGGTGATCGTCTCTTGGAGGACTGC