Description :
From Genome Similarity Track
Location :
Scaffold_5271:11- 1484
Sequence
1473 bases(100 bases per row)
TTCCGCCCCCAACAAGGGCAACTTCAAGATTGCCCGCCACAATTCATCACGATTCAAAAATGAATTGCACATGAACTGATTTACGTTAAATGAGGGAACG
AAGATCTCAGGTTGGCGGAACGCAATAAGCTGAGCACAGGATTGTCTATCGTCAAGAGCACCACCTCCATTGTCGGCATGCCTCCTTCCACTCGTGCCAT
CTTGGTGTCCATCCCGGCATCCAACTACGTCGAGAAGGCGCGATGGGCGCTGCAGCTGGCCAAGATCCCGTTCGTCGAAGTCAAGCACATGCCGATTTTC
CATCGCTCCTCAACCAAGCCGTTGGGCGGCAGGAGCGTTCCGCTCTTGTCGCTCCCCGACAGCAAAACCGTCTTGCGCAACAGCTCCGAGATTCTCGATT
TCTGCGCGAAAAGTGAGCCGTCGCTGTACCCGAACGATGGCGTGAAGCAGCGCGAGCTCTACTACGACAAGGAGTTTGGCCCCGCGACTCGTGTTGTCGG
TAAGACCACCAAACCCTCGTTGTCTTGTCATTGGTAACGCCTCGTTTACCGGCTATTTCTTGCGTGTACAGCTTATTGGTGTCTGTTCAAGAAGATGTCG
GTTGCACGGAGAATTATCGTGTCGCCGGCGAGCAGCCTCCGCGAACGAGTGCTCGGGTTCTTCCTCCTACCGTACATGCGTGTAGTTCTCTACCGGTATA
TGACCGTCACTGAAGACAATGTGGCCCTCTCCGTTGACAAGATCGAGTCGATTGTACAAGACGCATGCGATCGACTAGGTGACGGCCCCGTTGGCTCACG
GTTCCTCGCTGGCGATACCTTCTCGGCCGCCGACATTGCCTTCTCTGCCCACTTCGGCCTCATCCTCGCACCGCCAGAGAACGTTTATCTCCAGCCGTAC
TTGAAGGAGATTGGGAATGAGCCTCAGCGATCCCGTCTCGAGGCGCTGCAGCAAAGCAAGGCTGCCGATTTCGTCCGCTGGTGCTACCAGCACAAGCGTC
CGCCGATGGTGTGATCTGTCACAAGTCACAGCCACAAATCGCATGGTCATCCAGGATTGGCCAAAAATACCGTTTTGATGCTCTCTAAGTGGTTAAAATA
GATAATAATCACGATTGGCCCACGTCGCCCAACTCTGACCAAGTTATTGAGAGGTTGATCAGCATACCAAAAGTGGCCGCGCCTCTGGCGATGCATTGCG
TTGAGTATGTGTGCAGAGTTTGCGTCNNNNNNNNNNGGCATACCAAAAGCGCCCCTGGCGATGCATTGCGTTGTGTATGTGTGCAGAGTTTGCGTCTCGG
GGCAGCGTGTGTGAAGCGGCACGAGAGAAGCGTCGGGCGCTGCGAAGTGCTTGTCTGCCTCTCTTGGCGTCCATGGCACGCGCTGCTGTTTCCCGGAAGA
ACGCGAGATCAATGTCGATCCTATGTGTGTAGAGAAGGCCGACTATATCCCATTGGAATACTTCTCAAGAACT