Description :
From Genome Similarity Track
Location :
Scaffold_1736:11- 1360
Transcript NameFunction/comments
Phyke_g12097hypothetical protein

Sequence
1349 bases(100 bases per row)
GTGGGGTACCTGAAGAGGATATTCTTGAATTCGATTTTGCCTTGTAGCTGTTGAGGGCGTAAGCCAAACTCGTCGAAGGAGTCGATTGGGGGTTCAAGAT
TTTTAATCGCGACAATTGCCTTCCCTGCTTTCACTGCATTGTCCGAATCTCCAAGAAATGAAGCGGCACTGCCAACACCTTGAGCTGACATCATGATAGC
CATAAGTGTACGAATAAGTTTTGCAAATGTGATGTCTCCGTCTTCAACCAGTTTCCCACCGTACCAAAACACGAGCGCATAGGTTGCAAACACGATGAAG
GAACTGAATCCCAAAGCAACACCATTCATCCGCGCTTCACGCCGTCCACTAGTCAAAggttcttccagcagatttTCAAACTTTGTGGTTAAAGGTTTCT
CCAAGCCCATCGAGACGACTGTCCGGATATTGCTTAGTGCTTCGGAAGCGTGCGCACCAACTTCCGCCAATTCATCTGACAAGACACTCCCATGTCGGAT
ATGGCGCATGCGAATAACCTGCCCCATAATAAGAAGTGGAAATACCGCAAGCATTACCAGAGTCAATAGCCAACTGCCCGTTGTGAACGAAATGATtagc
gcagcaacaaaagtGAATGCTGCCTGGACAACGCGACCTTGAGAATCACCCGAAATCATGGCAACCTTTGTAGCATTTGTCGACAGATCTGCTGTGAGGG
CTCCTGTGGCGTTCTTGGTTTCATCGAAAAACGCGATGTTTTGGCGGCACAGAGATGAAAAATGAATGCCGCGCAATCGCGAAGTCAGCTTCTCCGCCAT
GTACCGGAAACAAAAGTTTTGGGTGGCATTGGTGATAAATAGCACCACAGCGCCCGCGATGTAGCATACACCGTACACCGTGACGTCGCTTGAAAGATTA
TCCAGGTATGACTGAAGCCCGTATGCTTGATAATTCGTGTAAGCGGTGGTCATGCTCGCAACCATTTCGCTAATCAAAATGGCCGAGCAAGGCATAGAAA
ACCCATTgataccagcagcaataagtccagtgacgaagaacttGCGCTCTGGTCGGCTAAATTCCAAGGCGTCCAAAATCGTAAACTTTCCATCGGCCAC
GTCCTCATTTCTCTCTTTCGGCTGTGAAGTGTCTACGTTTTGATCATTTTCAAACGACCGACCGCTGATTTTACGACTCGCCTTAGGCTCAACGGCAGAA
TTTCCTGCATATGCTAAGGCCGCTGCGGCTGTCTCTGCCTCTTCTTGAACTTTCTCTTCCTGAATCGTGTACAATTTACGGTAAATGCCATTCTCAATAG
CCACCAACTCGTCGTGAGGaccctcctccaccacatgACCGCTGTTCAC