Description :
From Genome Similarity Track
Location :
Scaffold_1738:11- 1357
Transcript NameFunction/comments
Phyke_g12099hypothetical protein

Sequence
1346 bases(100 bases per row)
GTGGGGTACCTGAAGAGGATATTCTTGAATTCGATTTTGCCTTGGAGTTGTTTAGGAACCAGACCGTCTTCTTGGAAGGAATCGATGGGTAGTTGACGGT
CTCGGAGATCAATGATCGCTTTTCCAGCTTTGAGAGCATGACCTGTGTCTGCGATAAACGTTGTAGCCAGTCCGATTCCCTGGGACGCCATCATGATGGC
CATGAGCGTTCGCATAAGTTCTGTGAAGCTGatgtcgccatcgtcgactAACTTGCCGCCGTACCAGAACGCTAACGCATATGCGGCAAACATTATGAAG
GAGCCGAAGCCTAGCGCGAGTCCGTTcacttgagcttctcgaCGACCATTTGCCAGTGGTTCCTCAAGAAGATCAGAAAACTTCGTAGCTGTTGACTTTT
CTAAGCCCAGAGAAGCAACAGTACGAATGTTGCTTAGAGCTTCAGAAGCTTGAGCGCCAACGCCAGATAGCTCATCAGACAACCCACCAGACGTTTTCAT
GTGTCGACCACGAACAAAATTCCCAAAGATTAAGAATGGACAGActgccatcatcaccaaTGTTAGCAGCCAACTGCCCAGGGAGAACGAAATCACCAGC
GCTGAGAGGATTGTGAAGACAATCTGAACGACGCGCCCCTGAGAATCACCGGAGATCAGAGCGACTTTCGTGGCATTCATTGATAGATCAGCCGTCAAAG
CTCCTGTAgcattcttcttctcatcgAAGAAGCCGATATTTTGACGGCACAATGCAGTGAAGTGAACATCGCGCAGTCGAGAGGTGAGCTTTTCAGCCAT
GTACTTGAAGGCGTAGTTCTGCAGGACAGTACAGAGACATACGACTACCGCACCACCGATGTAGCAGAGTCCGTAGACCATCACGTCGTCTGACAGATCA
TCGAGAGAAGATTTCATATGTGATACTTGGTACGCGGCATACTTGGTCGTCATGGTTGACACCAACTCGCTGATCAGGATGGCTGAAACAGGTAAGCCAC
AGCCCAAGATTGCGGACGCAATAAtgccaacaacaaaagcCTTCCTCTCCGGGTAGCTGAGGGCGATAGCATCCAAAATTGTGAACTTTGAAGAGTTTTC
ACACCCCTCCAACGTGGTGTTTGACGCATTTTCTTTGAAATCGCCACCTCCAGATCGACTACTCAATCGCCGTATTAATTCGGTTTTGGTTTCAACATCA
CCAGCTACAGCCAGCGccgttgctgccgcctctGCCTCTTCTTGAACTTTCTCTTCCTGAATCGTGTACAATTTACGGTAAATGCCATTCTCAATAGCCA
CCAACTCGTCGTGAGGaccctcctccaccacatgACCGCTGTTCAC