Description :
From Genome Similarity Track
Location :
Scaffold_3891:11- 1254
Transcript NameFunction/comments
Phypl_g16080hypothetical protein PHYSODRAFT_339130

Sequence
1243 bases(100 bases per row)
CTACCGACGGGTACATAAGGTGACCagttcagcacgatcacggatCATCGGGGGAtcccctccgttagtcggtgtctgggAAGTCGGATCTGGCAATCTC
GCAGATTTTGCTGATCCCACTACACCACAGTGGTGCGCGCGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCTCAAGATGAAGTTCAAGTGAA
GATTGAACAAGGGGAACAAGCGTCATCGGACCTCGGATTGACGATGACGCCGCTAAATGAAGCAAGATCCGCGGATCAACAGAGTGCTGGCAGGAACTCT
GTTGACGGAATAGAGGGTGATCTGGCGACAGATCACGAAGAGAAACCTCAATCTCCTCCACAGGTCCCCTCGGGGACCCCGGCGGATCTCGACCCGCGTC
GATATCTGCCAACAAAAGAGCGGACAGCGAAAGCTGAACGGCATGCATTTGCGAATTCGTCGATTAAGCAGATGCAGTATCCGCACAAAACCCCACTAGT
CTCACGATTTGATCAagaaaagaagaagacgaagactACGCGGATGAAAATGAAGGCTCCAGAGGCAGAAGGCAAATACCACACCGAACCCATGATTGGG
TGGTCTGCAGAAGCCCTGGAGCACATGTTCCACCACAGGGAGCTACATAAATTCCTAGATCAAGATCTAGTAATGAAGAtcctgaagctgaagcagatcg
gAGATCCTGAGGAACCCGTGACGGCTCCTGTGACGACGAACAAtaagctggaggtggtgaaaGATCTACTACGGCTGTTGAAGGAAGCAGGTATACTCGC
CGGTGCATTCGATGCGAACGGTCTGCTCGACATGGAtctggacgcgctgcagtttgCCACGCGATTCATCTTCGGGAAGCTGATGATCTTGGTCGGTGAA
GCTCCTAGATCCCCATATCTGGAGTCGACATCCCGGATCAGCGCAACGGCATCGTCGCACTACGCCTCGGCAGCCGAGGATGGTTCGGATACCTCGTCGG
AACCCCGACGAATGGTGCTCGGCCCTTCTGGTGCATCGCTACTGGAGGCGCGATCGAAGATCCAACGTCAGGGTTCCCGATCTAGTGCCCGAAAGAAGAC
ATCTCCTTCGACGGACCAGATCGGAACTGCTACGGCCCCAAACGAGTCGCCTGACACGTTGCAAAAGTACTTCCAAGCCGCCATGAGCCGATTCCTGTTG
GAACaacaagtggcagcagtccTACCTGCAACCAAGACGCCTC