Description :
From Genome Similarity Track
Location :
Scaffold_3988:11- 1133
Sequence
1122 bases(100 bases per row)
TTGTCATGGGAGCAGCCACACCAAGATGCATTCGAAGGCATCAAGAGGATCCTCCAGCGTGCTCCTGTCTTGGCATTGTCAGACGAGTCGAAGATGTTTA
GCGTCGTCTGTGACGCTTCCGACTATGCAATCGGTAGCACACTGtagcaggacgacgagcatGGACACGAGCGTGTTATCTCGTTCCAGTCCAGGCAGCT
TAATGCTGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCACCTGGCTATGGAGTACACCCTTGTCAACTTTAGGGTGCACCTCCTGGTCCCAAGGCCC
TTTGTGATCTACACATACCACGCGTCCTTGCGGGCGGCCCAACTCGCCGCATCTGTCGCAGCGGATGGCGCGCTGGCTGTCCTTCTTCGCGGAATACACC
TTCCGCGTTGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCCGACGCGTNAACACCTTCCGCGTTGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCcga
cgcgtcgtcgcgcagACCCGACTATGAGCTTGCTCACACCAGTCGGGTCGCGTCGGTTCTGTACGATCAGATACGCATGGTGTATCCAgaggacgaggtg
ctcgcACCTCTAGTTCGGTACCTGACCGCCGGCAAGGATGCCAAGGCTGACTGGTTGTCGCCACGACAGCGGTCCCGCCTCCACCGATATGAGTGGACAG
AGAGCCTGCTCCACTATCGCGTGGAGCCTAGTGATCCTCATCGTGTTGTTGTTCCAAACGACGAGGATCTGAAGTACTTCAGGAGACACACGATGCGCCA
GCCAGTGGCCACTTGGGCCGAGAGAAGACCTTCCATTCGGTCTCTCAGTTGTTCTGGTGGAACCACATGTACAAATGGGTTGCAACCTACGTTAAGACAT
GTGAAACATGTCAGCGTATCAAGCCTGCGGGCCACGCATTGGCTCCTTTGCAGACCCTGCCAGTGTCACTGGAGTGCTGGAGGTCGATGAGCCTCGACTT
GCCCTTGGCTTTCCAGTCGATGACCGCGACAACACCGATATTTTGGTGTTTGCGTGCCGTCTGAGCAAGACGGTGCACCTTGCTCCGGTTCCCGACACTG
TCACCGGGGAACAAGCCGCGAG