Description :
From Genome Similarity Track
Location :
Scaffold_374:11- 1059
Transcript NameFunction/comments
Phypl_g7565hypothetical protein

Sequence
1048 bases(100 bases per row)
CGGCACCAGGGGATAACGCATCCCATTCAAGTAGAACGGGGTGTATCCCGTTGACGCATGCACTGCGTTGTTGAGTGCAAACTCAACCATGGGCAGCCGT
GCTGCCCACGTGCTCGGCGCCTCAGCACAGACACTGCGCAGCGTGTCTTCAAGGACGCGGTTAACGCGCTCCGTCTGCCCGTCCGTTTGAGGATGGTCAG
CAGTTGACATGAGCAACTTCGTTCCCAGTAGCTGGGACAGCGTTTTCCAAAACGCAGCGGTAAACCGCGGGTCTCGATCAGAGACAATGGTCTCCGGAAG
ACCGTGATAGCGGAACACGCAATCCAGGAACAGCCTCGCGGCTTGTTCCCCGGTGACCGTATCGGGAACCGGAGCAAGATGCACCATCTTGCTCAGGCGG
CACACAAACACCAAAATACCGGTGTTGCCGCGGTCGTCGGCTGGAAAACCAAAGNGGAGCCGATGCGTGGCCCGCAGGCTTGACACGCTGACATGTTTCA
CATGTCTTGACGTAGGTGGCAACCCACTTGTACATGTGGTTCCACCAGAACGACTGAGAGACCGAATGGAAGGTCTTCTCTCGGCCCAAGTGGCCACTGG
CTGGCGCATCGTGCGCCTCTTGAAGTATGTCGTACTTCAGATCCTCGTCGTTTGGAACAACGACACGAGGAGGATCACTAGGCTCCACGCGATAGTGGAG
CAGGCCATCTGCCCACTCATATCGGTGGAGGCGGGACCGCTGCCGCGGCGACAACCAGTCAGCCTTGGCATCCTTGCCGGCGGTCAGGTACCGCACTAGA
GGCACGAGCATCTCGTCCTCTCGATACGCCATGCGTATCCGATCGTACAGATCCGACGTGACCCGACTGATGTGAGCGAGCTCATAGTCGGGTCTGCGCG
ACAACGCGTCGGCAAGCACGTTGAGCTTGCCCGGCTTGTACTCAACGCGGAAGGTGTATTCCGCGAAGAAGGACAGCCAGCGCGCCATCCGCTGCGACAG
ATGCGGCGAGTTGGTGGCCGTCCGCAAGGACGCGTNNNNNNNNNNNNC