Description :
From Genome Similarity Track
Location :
Scaffold_38:11- 1043
Sequence
1032 bases(100 bases per row)
AGGAATACAAGGGATCATGAAGGTTTTTAGATATTGATGACCCACTACGCGCACTGAGTGATGCTTTCGTGTGTCCTCCATAACGGCTTCATCCAAAAGT
GAAGAAGAGTTCAACTCTATGATGTCGTGTCGAATGACCACCACCTCTGAAAGGTCTCCATTCTTTAGTGAGTGATCATACTCATCGACCGACAACTCTT
CGAGTTCTAAAAGCGAACTTAACGAGGGTATAGCCTCAAGGCTAATCTTACCATCACAGGCACCAGTCACTCCGTTGACGAGTGTATACAGCTGAAAGTC
ATCATCACTTTGTGACACAGCACACGATATGTGATTCTTAACTCTCTGATCGATACCATTCTCCACCTTAATTTGCTCCAAACCCAAACTGAACGCCCTA
ATGGAATTCGATGACATGTCATTGGGACATGGGCATCGTCTTTACGTGGAATTACGTGCCACTTTCGCGTGCATCTGCTGAGCCGGGCTCGGGATGCCTT
GGTATTTCACCAAAACGTCAATATTGACATTCAGCGCGTAGCTATCACACTCAACGTCACTCAGTGGTTAGTTACGTGCCACGCCACGCCACGCTCATCT
GATGGGTTCAACCCTCGATGATTTGACGCTTGGTCAACAAAGCTTTCAGCATTCAGTACGTTGACCTCACAACGACTATCACTTAGCCGAGTACGTGCCG
CTTCACTATCACATATCGAGCTTTGATCTATACTCATGTCTTTGACATCGTCAGGATCAACTAACTCTGACATTCCGATGTCCAGCACACTGACATTGTC
AGCCAGTGGCTCGCGCCAAATAACGCTTCTGATTTCTATCAGAGGTGAGTTCATGACTCTCCAAGGCTCCTCTAGGGGCAGTGCGCGTGGCGCCTAATGT
TTCCGACCTCCAGTCGATCCATGGCTCATAGTGCTCAAGCCAAGCCATACCAAGAATGAGATCATATCTAGAGTCCAAATCAAGGACTAAACAGCGTTCG
ACACTATCAAAATCAACCAGGGTTTGTCAAAG