Description :
From Genome Similarity Track
Location :
Scaffold_805:11- 1043
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_805-fgenesh-gene-0.3Ferric reductase

Sequence
1032 bases(100 bases per row)
AGATCTTGTGGAACTCGATGTGGTCGTCGAATGGGATGTACTTCCAGAGCAGGTGGCTGCGCTTCATCACCTGCGTGATGGAGCGGCACATGGGCAGGAT
CACGAGCACGCAGTTAAGCATGCACACCTGGGCGCAGCCACGCGCGATGCGCAGGCCCCAGCCCAGGGCCGGGTCCACGTTGTAGCTGAACCACTTGAGC
CAGAACGCGGCGTTGTTGAGCAACACATAGAAGAGCAACCACCAGACGCGCAGCGCGTTGGCCTCGTACCACGTGTGAAACTTGGACTTTGGTGCGCGCG
TGCGCATGGACGAGTGGTGGGGTTGCTTGAGGCCGCCGCCGGTGGTTTCTTCCTTCTTAACGTCGTACGAGCCGCTGACGTACGTGTGGAAGACGTACTT
GAACTGGGCAAAGGACATGCCGCCGTCCTTGATGTTGGCCTTGCGGAACATGAGCGTGGCCACGGTCGTGAAGTCCGTGCCGACGACCTCGATCTTGGCG
GATGAGAAGTTGGCCGTGAGCAGCTGCACGATCTGGTCCTCGGTCACAAAGCCGCAGGCGCTCGCATCGAGCGTGTCGAAGATGAACTTGAGCTTGTCCT
CGACGCCGACGTCGAGCTCCATGACGGCGTCGATGAGGATCGCGTTGGTGTCGATCATGCCGTCGGCGCCCTGGTCGTACTCGTCGTAGTCGTCGCTGTC
GACCTCAAAGGCCTGCGAGAAGGTCGCGCGGTCGATGTAGCCGCGCTTGTCGGCCATGCCGCCCATCACATCGCGCAGCGCCTGGAGCTTGGACATGGGC
GTGAACTCGCCGTCGTGGTGGTCGTCCTGCGAGATGGCGATCTGATACTGTTGCTCAAAGTTGCAATCACCGAGGATCGGCACAGACACGACGTCGCTCG
CGGCCGCGGGCTGCAGGCCGCTGAACGACGGCTTGAAGCCCGATATGTTGGAGAAGCGCGAGAGCCGCTCGCCCACGACCGAGGACCGCAGCATGGCGTC
CACATTCGGGCGGCGACGGCGACGGCCACCGC