Description :
From Genome Similarity Track
Location :
Scaffold_591:11- 1012
Transcript NameFunction/comments
Physo_145187reverse transcriptase

Sequence
1001 bases(100 bases per row)
CGAACTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATGACGAAGAACCCAGTGAACCACGGTCGCGCCAAGCACATCGACATCAAGTACCACCAC
ATCCGCGATGAAGTCAAGCGCGGCGAAGTCAAGCTCCAGTACTGCGAGACTTCTGTGATGCTAGCGGACATCATGACGAAGGCGCTTGCGGGACCACGCC
ACACGGATCTGACGGTGGCTCTCGGCATTCGTGGGACTTCGCATTGAGGGGGCGTATTGAGGGTTGCTGGTCTTGGGTACTGTGTACCAGTTGTACCCAT
TATCCGGTTAACCCGAACCGGTCCAATCCGAACCCACGTTGATTATGGTGATTACGGTAAGTTGTTTACGCCACCGATGATTAGACGAGTAGGATGATTG
GATGAACACCGGTGAGTGATGGTTGATTAGATGCACTAGGTGATAGGACGCAGGGTCGCGTGTCTATAACAGTAGGGTGTAAGCTCCAACAATTCAATCA
CTTTCGAATCTTCATTCTACCCCTCAAGTGCCTTCGCTCCGGTCCCGCCGTCTGCGACGTCCCTCCCTCCGCTTCGTCCGAGCTTCGTGTCCAAGATCCA
TACCTTCCATCAGATGACATTCTTGTGACGGCCGGGTCATGGGATGAGCTGTGCGATCGTGTGGATCACCTGTTGGACGCTTGTGATAAGTGGAATCTCT
CGATCAGTGTGGAGAAGAGCTCGTGGGGGATGCGTAAGGTGGACTATCTGGGACATCGTGTGTCGAACGACGGGCTAGAGGCCAACCCGAAGGATCTCAC
TGCTCTGACTGATCTGCCGTTCCCCGGATCGCTCCGATCGACGCAGTCATTCTTGGGCAGTCTCAACTACTACAGCCGTTTCTTGGAAGATTACGCGATC
TACGCGTCGATCCTGTATGAACTGCGCGAGGTGGACTTCGCCGAGCTGAAGAAGCGCCCTGATCTGCGCCAGATCCTGGATCGTCAAGTGCCGAACTTAG
T