Description :
From Genome Similarity Track
Location :
Scaffold_11:109985- 153996
Transcript NameFunction/comments
Phymu_g855conserved hypothetical protein
Phymu_g856hypothetical protein PHYSODRAFT_293744
Phymu_g857hypothetical protein PHYSODRAFT_293746
Phymu_g858U4/U6 small nuclear ribonucleoprotein Prp31
Phymu_g859hypothetical protein PHYSODRAFT_343735
Phymu_g860hypothetical protein PHYSODRAFT_321823
Phymu_g861conserved hypothetical protein
Phymu_g862DEAD/DEAH box RNA helicase, putative
Phymu_g863hypothetical protein PHYSODRAFT_309064
Phymu_g864HSF-type DNA-binding protein, putative
Phymu_g865hypothetical protein
Phymu_g866conserved hypothetical protein
Phymu_g867Intraflagellar Transport Protein 140
Phymu_g868hypothetical protein PHYSODRAFT_321832
Phymu_g869hypothetical protein PHYSODRAFT_476353
Phymu_g870hypothetical protein PHYSODRAFT_293759
Phymu_g871conserved hypothetical protein
Phymu_g872prolyl-tRNA synthetase, putative

Sequence
44011 bases(100 bases per row)
CGAAGCGAGAACATCTCGACGAGGAGTCGGACGCCGCCGCGCTGGTACACCCAGCTTCGATCGCTAAAGCTGTTGGTGCAGTGCTGGACTACAGTAATTC
GTACCTGGGAGATGATAAGTTCGCGGCTATCGCCGAGAAGATCCGCCTCGCGAACGGCCCAACGCGATTGGATCTGCGTGGCAATTGTTTCGAAGCGGGg
gctgctcgagctcttgcGGCGTTAATACGGTCCCCCCACAACGTGGTGGCTATCAGTCTCGAATGGAACAACATCGGTCTTCTCGACCAGGGCGTGGAGG
CTCTCGCTGGTGCTTTAGAAGTGGACAAGCGGTTGCTGATCCTCGACTTacgcaacaacaacattGGACCGGAAGGTGCCAAGGCTCTCGCAAAATCTCT
TCGGGTGAATCGCACACTGCGTCAGTTGGATTTGCGTTGGAATGAGATCGGGAATCCTGGAGTATTGGCATTTCGAGAAGCTTTGCAGAGCAACCACTCG
CTGGTgacactggagctcatgggGAACAACACCAGCTTGAAGCATGtcgacgagatcgaagcgTTGCTGGCTCGGAATCGAGTGTTTGCAGAGAGACCAT
CACCGGTTGCTGTCGATGCGTCTTGTCAAAACGATGATGAGGTCGGATCCAACAACGGAAGCCCCAAAGCTGCCCCCGATGACCAATTGCTGTTGCAAGT
TCTAACGGAaaaggaagagctggagacggaACTCGATTTAGGCAAACGAGAACGCCGGAAAATGGTGGAGAggacggaagagctcgagatgcagctgcag
caaagcaATAAGGACGCTCAAGTAGCCAAGGAGGAGCGAGATCGTTATCAACAACGGGAAATTGACGCAAAACGTGACGTTCACGAGTTGAGAATGCAGC
TGGACGAACTCGAAAACCGTAGGAAACTGGAGTTCGAAGAGTACCGATCAGCAAGAACAGCTCTCGAGAGGGAGAATGGAGTTATCCGAGAGAAGATGGC
TCACATGGAGGCTCTGCGAAACAAGGAAGCAGATGAAAAAGACAAGCAGATCTCACAGATGGAAGCGGCCAAGTATGCGCTCGACAACGAGCTCCACCGC
ACGTCTCTCACGTTACGGTAAGTAGACCAGCAGTTCGATCATTCCTCTATCACACAAGACTTACTCTTTGCTGAAtagagctcaagaagaagaggttggG
AGGCtacagaagcagcttcaagaggCTCAACAGGAGTATACTCGCAAAGAAAGCAAGTTGTTATCGGAGTATGAAGGCAGCTTGAGCGCCTCCCAGCGAC
AGCATGATATGGTTCTTGGGTCTTTACAGACGCAGCTCAGCTACACGTCAACGAACCTCGAAGCGAGCGAGCGAACCGTCCGAGAGCTTAAAGAAAAAGG
TGAAGCTTTGCAAgccaaactgctgcagtccCAGATCGACCACGAGAAACTCGTTGGTGAtctcaagcagcagtgggAAGCAGACGCGCAGGAGCGTATC
CAGCGTTCGGTCGGTTCCGTTGAGGCGCAAGTTGccgaggtgaagaaggcgcgcCAATGTCTGGAGCGAGAGGTGGAAAAACACCTCGAGACCATTATCC
AGGTCCGACAGGATAATGTATCGTTGCAACAGTCGAGAGACGAAAAGCAGAACGAACTGGAGACCGCATTGGAGACGCAGGTCAAGGCGCTACAGGAAAA
GCAGATAcaattggctgcagcagtgagCGAGCGCTCCCGGTGTGAAGagaagttgcagctccaggtgcggaagatggaggagcaggaTGACCGACTTGTT
CAGATACAGGCAAGCTTCGACGAACGGGTCCAGGTGAGTCTGTCTGTAGAATATCTTCCCGCGTCGCCTTATACTTACGTATATCGTTGCTAGGTCCTCA
CCACGAATGCAAAGATCGTGAATGAGGAGAATGCAGTCGTATTGAAGGAGAAGGCAACGCTCGTAACGTCTCTGGAAAatcaggtgctgcagctggagcg
agAGCTGTCGGCGTTGAACCACGAGCATGAAAAGCGCATCGACGACTTGGCCGAGTCCTTTGGGCGTTTcgtgcaggagcagatcgGCAAGGAGCGAAAA
CGCCGCAAGAAACCGAGTTCCGACGCGGCGAGGTCCGACGCCTAGTAAAGCGTAGGCGCCTGTTTGTAGTGACGTGGTGCCGAGTCGGCACCAAATCAAA
GCGGCGGAGGACTCGCTCCGGCACCGTCACCATGCAAAATGCAGCTGCACGGAGCCCATCGAGGTCTTAAGTAGCGTTTCAAGGCGACAAGTTCTCTGCC
AAGAAATAACCGTAACGAAATGATACATGCACGGGGTATTGCTACATCATGTCGTGTTCTGGAATGTGACAGGCTTTGCTGATTGGCCGTTTCAAAACTG
TGGACTGGCCGAAAATCGAATTTTTGTCGCACCATATGTCGCTGGACGCATCACGCGCGATCTTTATTCGCGCGCTTGGATTCAAATATGATATCCATCT
ATTGGCTGAAACAAAGCTGTAAATTATTCCATTGGCGCAAACTCGAAACGGCGCCATCAACGGTGTTGAAGCGCCTGCACCAAGCGTTTTATATACCGCA
GTCCGGAAAATGCCAGCCCCCGGAGGCTTGCCCGCTTTGCGACGTTGGCAGCCAACTTGGCTGACACAAGGCCGGCGTTCAGGCAGTACTGGAGAGAAGA
CCGGAAAGGCCAGCACCCTGGCACGTTTTCAAACGTGTTGACCGCCACAAGCCGCCCACCACTTGCGCTTTCACTCCCGAGGGCGTACACGAACGAGATT
CTGCTAAGTGGTGCTTAAGCGTATTGACCTAATTGAGAAACGCTTGCATCTTAGTCGCGTCACCGAAGTCCAAATCAGTTCACACGCACGATGGACCGCA
ACATGAGCGTGCAGACGCTTATTAGCCGGTTTGAGTTCATGGCACAGGCCAACGCCTCATCAGCGGCACCACGCACATGGTCAGTGACGAGAAACACGAT
TACTGAGCTGCCACCACAGCCAAAATCCGACAACTCGGCAGTGAAGGAGATCATCACCCGCATCAACACACAGCGCGCTCGCACGCAGTCGGAACCCATG
CAAAGGATGCAAAAGCGCGAACAGTctgccaaggagaaggaagaggagaaaccGGAGACCCCAGTCGCTCAGTTAACCACTCCGACGACGCCTGATGTTT
ACAAAAGTCTTACAGTGAAAACGTCTCTGCCTGTCGACGAAGATGATGCCACGACTGTCAACACGTACGAAAACGAGAGCGACGCAGAATCGACCACTAC
GACCAAGCCCAGGAGCTACTTGACCGTCCCGCGCAGTCCATCAGCCTACTCAACTACTTCTACGGGGTCACTGGACTCTCTTCTAAGCTCGTTGGATATG
TTCTTGcccgagcttcttctggcgtCGCGTGAAAGCAGTCCCGAGATATCCAGGAGTATCAAGCACACAGCATACCATTCGAGACGCTCGTCGCTGCCTG
AAACCTTGCAATCTACAAGAACGTCCAAGTTGATTCCGCCAACATCATACCGACGAGCTTCACTTTCGGGAAAGTTATCATCCGCGTCGACGAAACAGAC
ACCAATACCGGCACCCAAGTCGCATCCAAACCAGCCACTGTTTGCACCTACACCAGCGAGACCCCGTCGCTCTTCTGTATCGGCCACCGCCAAATCAACT
CGCCGTTTCTCGGACTCGGCACATAGTCTTCCACCTGTgacttcatctcctcgtGCGAGAAGCCGATCGAAGTCGTCGAGTGTCCCTCGGTACATGGACT
ACGACAGTTCTCCGCGCTTCATGGCCACCAAGGCCATGAATATGGAGCGCCGGCGCCACTTGGAGGAACGCAACCGCAATCTCGCTGCCAACAAGGTTAA
ACACCTTAGCACCAACGCTACACGGAAGCCACGAACTCCGGAGTGGCAAGGTCGCCTTGACCAGGTGCGGTCCTGCCTGTttgacgacaaggacgacaac
CAAACCGGTTACCAATCGCACGCAGTCAAGGCGAAGAGAGCGGCACCACGCAGGCATTCAGCCTCAAGTCACTCTTGTTTCTGAGAGCAATTTGGTGCTT
GCGCCCTCCCCTGCGCATACCATCACTGCATGTTTTCGTGCCTACCACGCCAGACACGATAACTTATACCATAAAACTATGCATACTTGACGGACTCCGG
TCTTGATTTGATATGCGGACGGAATTCctaatgtagccatttattgtcagagtgatggtccaggacttgaacttcttgatACTGCGTTTCGATTGGCTGA
GAGCACGCAAAACGTGTGGTTCCGGTTTCTGACACAAAAACATGAAAGCAAAGGTCGTGTGAACTtgagccaccaccaccgacATGACAGCCACGTCCGC
TGCATCCTTCTCCCCCACGGGCTACAGCCTCGCAGCCAGCTATTACTGTCTCCATGCAAGCGGCGAAGTTGCCCAACACAACAACATCGTGGAGTCTCCC
AAGCCAACCGAGACCAAACCCATTGACGCCACTAAACCCGATGATGTGCAAGTGCCACGACTGCCACTAAGCGAACTGAATTGGAAGAACCGCGCCCGTt
tcttggagatgatgcagcgCCATTCGTTTGTGGTGCTCACGGAACTGGGTGAGAGCCTGGAGCGTACTCACGAccaggtgctgcaggactTCGAGACGTT
CTTCACTAGCGGCGATGAGGACTGGAAGAACGGCTGCACTAGCAAGCAAGTGTACCTCAACGAGGATGGTAAGCCCTTCTGGTACGCTGGATACGAACAT
ACCAGTGTGCGTGACTGCTTCCGTGTGGCCTGCGGGGACATGTCGAGGCTCATTTGGCCGTCGCCCGACTTTAAGAACCACTGGCTGTCTCTGCAGCGAC
GCATGCAGCGTATTTGTGACCGGGCTCTGAGTTTGACGGTCGGCTACGACGTTGAACCGAGCCACTCTCGCTCAGACAAGGACTTTTCGGTGTGTTACGG
ACTGCACTACCCCAACATTCAAGGAAGTGGCCAATCCGAGACAGAAAATGTTTTCGAGCATGTGGATCCGAGCCTTTACGTCGTGGAACCTGTGCCAAAT
GTGGAGGGATTGGATGTATACGACCCGCACTCCAAGCAGTGGCTTAAGGCTGAAAAAGTATGTGTTCCCGGTAAGGAGATTGTGCTCTTCTGTGGTCATG
CCTTGAATCGAGCCACTGAAGGTCGCATCCCGGGAACTTTACACCGTGTTCGTCGTACTCCCGACCGGAGATTTTGCATCATTTACGAGCAAAAGTACGA
AGAGTACTTCCTATGACTGCCACAGGATGGAGAAGCTAGCCAAACAGGAGAATTTTTGCCGAAAAACAGTGGAGCTATAGCGTCACGTACTTCATGACAT
TGGAGTACTGTATGTCAAGCAATAACGTCATCGAATACTGGCAGATGAACGGCTTAATATCTTGTAAGTTGTAGGCAACGATTGTTTTCAAACCGAGTGA
TCAACGCACGTGGAGCAAAGCTCGAGAATCATATGCCAGATACGGGGCCTTTAAATCTCTAGGCAACGGAATCAAATGCGACTGCAGGAGGTGTTTACAA
AACCTCAACTATCGATATTCTGTTCGAGGCCTTCCTGCTCAATCGATAACGACGTTCCAAGTGCGTCTAAGCGTAAATCACCAGGAATCAAAATGCCACC
GGAAAAAACTATTTTTTCGCCAACATGGAATTTACGTTTTAATTCTGCTCTGATTCCAACGTACTGGTAGCTCAAGACCGAGATTGGCCATTGTAATGCA
ACTAAAGGCTGGTAGTGGTAAGATCTTTCTTGAACAAGTTTGAGCTAAGAAAAAGCGTCGATGGACACATCAACTGCATTGCTTAGTCCGTGAGATTCAT
ACGAATCCTCCAAGTGCAGATCTTACTCGGATCCACAGATGATGGCATTGCTCCACCGTACTGtacaccttctccagcaaatGCATGGTTTCATCATGTC
TTTTGAGTAGTTTGTACGCACGCTTTTCCCATCCCTACAGGCTGGTGTCCTTGTCTCTGATTGCTTCCCATTTCTAAATCTCCATCGTCCAAGCGATAAG
CACTCGAAATGGTTAACGTTAATGCTCAATCATTTCTAACGTCAATTTTTGCTCTAGCCATTCTGGCCAACTCAGCAACAGCTTACCGAATTTCGGTGAC
AACCAACACTCTTGTGGAATCATGGGAAGGCTGGGGGACATCGCTCTCGTGGTGGGCCAACGTCTTCGGAGACCGCGAGGACATCGCAGACGTCCTCTTC
ACCAACATgtcgtccgtctccatcgacggAGCTGCGAAAGACATCCCCGCACtcgacttcaacatcgcaCGCTACAACATCGGCGGTTCTGGGAGCAACG
tcatcgacgacagcggcacGGAGATCGCGATGAAGACGTCCGACAAGATGCCTGCGTTCAAGGCCATCGAGTCGTTCTGGCTGGACTGGACAAGTACAGA
CCCTGCGTCGAAAAGCTGGAACTGGGAGCTGGACGCCAGCCAGCGAGCCATGCTGGGTCTGGCATCGAAGCGAGGCGCGGACGTTTTCGAGGCGTACTCG
AACTCGCCTCCGTGGTGGATGACAAGCAACCGAGCAaccgctggtggagaagacggagctgctgacaATCTCAAAGCGGAGTACTTCGAGCAGTTTGCGC
TGTATTTGGCGACGGTGGTGAACAAGGCGAAAGCAGACTGGGGCATCGAGTTCAAGTACGTTTCACCGTTCAACGAGGCAAACAGCAAGGCCTGGACGTT
TCCAGAGTCTCAGGAGGCTTGTCATGTGGGGATCAAGACGCAGAGTGACatcttgacgttgttgcGAACGCAGTTGGATAAACTCGATCTCAAGAATGTG
GTTGTTTCGGGGGCTGAGGAGAAGAGCCCTGACGATTCGGTGTTTATCCTGACGAGTATGATTCCTGACGAAATGCCTGGGCTTGGCGCCATGGGAAAGA
TTAACACGCATTGTTCCGATGGGATAATCCCGTATACCGGTGACAACCGCGATCAATTCAAAGGAATCATTTCATCTAAACCTCTCTGGGACTCGATGTA
CGCCGACGAGGACGGCACAGGACTCACCATGGCTCAAAACATCGCCAGAGACATTAACGAAATGGGAGCCTCAGCATTCGTCTACAGACAAGCCCTCGAC
AGTGGAGTGGTGGGACTCATTCAGTCGAACCCTGGAGACAAATGGATCGGTACAGCCAACCCGAAACATTACGTGATGGCTCACTACTCTCGTCACATCC
GTGCTGGTATGGTGATCCTTAAGTTTGACGACCCAAACACTTTGCTTCCTGGTTCATCGGAGTACGCTTTGGATATTTACCCGAACTTTGTCATTGCCTA
TGACAAAGCCACAAAAGTGCTGGTGATCGTAGCGACAAACCTGGGAGAAGCAGAGACGATTACGTTTGACTTGTCGGCTCTTGCTAGTGCAGATGGGCCG
ATCAACACTTGGACAACTGAACCTAACACGACCGCAGGAGCTGTGTACAAGACTTCCAGTCTCGACATCCTTTTCGGCCAAAGTGCCAGGTTTTCTGCag
atcttccagctcaatCGATCATGACACTGGAAGTTCTAGGAGCTGAATTGGCCAGTACTGTCGCTTTGTAGGCGCTGGAAGCTAAAAGGGGGCACAGTTA
GTTCGGATGGCGCAGCACAAGAATAATGCAAACACGACAACACCTTCAAAGCCAATGTACACAGTGTTGACTCCAGCGAAAGATTAAAATGCCAGTCATT
ATCCACTGCCCAATCGAAATCATGGCTTCTTGACAACGCTGACGAATCCACTAGCTGCAGAAAAATACTTTTTGTTCGCCTCAGCAACTCGAGCCTTCGC
AGCTTCAGGGTTCATAAGCTCGATGCCCTGCACAGGCGTGAAAGCAAGGCTCGACGCCAGACCAGAGAGCGGTGGCTTGTTAGCAGAAGATGCGGCAAAG
TTGGCCGCACGCAGCTTTTTACTTgactgcttctgctccttgcGCATAATACGCAAGTTGCCCGATCCTTCCTGCCCGAGACGGCCGGATGTAATTCCCA
TGGCATTATCTCCATACTCTTCATCCGCTGTAGCAAAGGACTGCCGGTTCATTTCGCGCCGTACGTCCGTCATCTGCAGTCGCTCCTTCATCTTACGATA
GCGCTTGCCGCCACGTTTACGACTCGGCTTTTCATCCGGAATCGGCAGtgccttcttgctcttggctTTCTGGGGCTCCTGCCATTTCTCCATTTTTCCC
ACGAGTTCGTTCCGGAACCGGGCACCGACTAAACCTTCACTGTCGTTCTGGTGTGGCTGGCTATCCACACGCGCCATCAACGCTAGCTTGCCAGCCACTG
CTCGGCACGCTTTCATCCGTAAATACGGCGGCATACTCTGCACCAGGTCACTAAAGAACAGCACGCCTGTGTGCTTAAGCGCAGCAGCGGACGAGAACCC
ACTGAGTACCTTTTTCTCCTGCCCCAGCACTTGCAAATTGCACGACGGAATCCGAGCCAGCTGCGCCACAcctccagcaagtccaaTGAGCTGGGCAGCA
ATACGCGTACCAACGAGCTGCGACACATTGGGCGCCAAGTACTTCATACGGCTCTCTACGAAGCGCAGGATCATGCTCTTGTCCTGATCCAGGGACAGCA
ACTCGTCACACGCTTCCATGCAGGTCTTCAGGTCTTCTGGGCCCAGCGGTTTGCCACTCGTACCGGAACCCGTCACGGAGATTCCAATCACTGCCGAGCT
AGGCAATAGTTTGGGCAGCTCTTCCACAAGTGTCAGGTCCATCTCATTGCCGATAGCTTTCACTACTTTCGTGTAGTCAAGAGCATTGGGAACGAGCGAG
TCGAGCTCTGGGAATTTGGCAGTGTAGATCTCGGCGATGAAGCGATGCACAgcttcgatctcgtcgtcaaTTTGCACCATCAGGTCGTTGGATGTCACCA
CCAGGTCGTACTCAGGGCTCCCCTCCTCCAACGGCTGCGGCTTGGATGCAGTTTCGTCCACATCCACGTATTTCTGAATCTTCTGCACGTGTGCCAGGTA
CTTGGGGGAACGTTTGAGCGATGCGACGGCTGCCACACCACGCTGTTTCACTTTGGAGCGTAGTGACTCGGCCAAGTCCTCGGTCTTATTCTCTGTGAGG
GTCTGGTCTTCATCTAAACGTTTCCGCTTGGCAGGTCTAGACTCGGACACCTCGGGCATCTGTTCGTCcgcgtcatcgtcttctgtGTGGCCGTTAGAGG
CATCAGGGAGAGAGGAAGACGTCAAcgtctcttcttcatcgctgcttcctccactgagctcgtccaggtcctCCAGGAACGAGTCCGCAAGTGTCGACAT
ATTTAGCGCTCTTCCTTGCTGTCTTAGTCGTTTGTTATTCAAAATCGCAATTAATTTATTTCTTATGAAACTAAATGATGGAATAAAATGACGCAAGATC
TGTACCCAAGATCTATGGAAAGAAAACGGCTACAATATGCTATAACATAGTTTCAACTACTGCGACTAACTGCATACAAAACGCAAGTCTTTttcgtctg
cagcgtgtCGGTTGGTGGAAAACCGTTTAACTTCTGAAGCGACAGACTTCTTCAGTTCCGCATTGTCAGCCTGCCCCCAAGTCGACGAAGAGAGAAGATG
CCTGGCCAGgagagcaacaacaacaactgGCGCCGCAAAACGCCTGCCGGAGAACGCAAGGACAGCGACGCtgagcacaagaagaagaaaccgcGTCGTG
GCGGCCGtcgcaacaacagcaacaagagTGGCAacgcaccagctcctgctgctcaagcacCTGCCGCTTCTGCGCCTGCTCCtactcctgctcctgtggA
GACCGTCAAACCCGCGAACCTGGACTACCTGTCGGACGTGTTGTTCGCGTCGCTTAACATCTCGGACAAATCCAAGCGAGCCATCGTGGAGGACCTGAAG
TACGAACGCCTTACCAATGTTCAGAACGAGACGTTCCCACTGATCTTGGAGGGGAAAGATGTGCTGGCTAAGGCCAAGACGGGAAACGGCAAGACGATTG
CTTTCTTGCTGCCGGTGATTGAGAACATGGTCAAGGACGGACGTCGCTCCGGTTCAATCCCTGCGCTCGCCATTTCGCCCACGCGtgagctggcgctgca
gatcgcCACCGAGGCCAAGCGCCTCACCAAGTTCCACGATCTTAACGTCACGTGCTTCGTGGGCGGCGCCAACATTAAGAAGGACGAGCGTGCGCTTACC
AGCAGCATGCCCATCGACATCTTGGTTGCCACCCCTGGCCGTCTGGTTGaccacttgaagcagaacacTGGCAACATTGTGAGCCGCCTGGGCAAGGCCA
ATGTATTGATactggacgaagctgaccGCCTGCTGGACATGGGCTTCCGCCCGGATGTGATGCGCATCATTGAGCACCTGCCGAGAGAGCGTCAGACTCT
GCTGTTCAGTGCCACGCTGCCTGCTTCAacggaggagctgaagaaggtcGCTTTGCGCAAGGACTACGCGTTCGTGGACACAATCGATGAAAACGAGGCT
GATACGAACGTGCAGACCGAACAGGAGTACGTGGTGTGCAAGATGGATAAAGTGATCCCGATGGTGGAGTCCATTCTGGAGGAGCACATGAAGCTGCCGG
CGTACAAGGTGATGCTGTTCTTCCCGACCGCTCGCTCGGCTCAGTTCATGgcccagctcttccaggccGCTGGTTTCCCGGGTGTGCTGGAGATTCACTC
CCGTAAGAGCCAGGCTGTGCGCACAAAGACTGCTGAAGCCTTCCGtaagggcaagaaggtgatgaTGTTCTCATCGGACGTGTCAGCTCGAGGTGTGGAC
TACCCGGATGTGTCGCTCGTGCTCCAGGTGGGCCTCACTGACCGCGACCAGTACATCCACCGTCTTGGACGTACCGCCCGTGCTGGAATGAAGGGCAAGG
GTGTTCTCGTTCTGTCCGAGTTCGAGACTCCTCTGTTGGACAAGCTGTCGGATTTGCCGTTGGAGCCGAGTACTAAGCACCTCCCTAATTCGTTGGAGCC
GTCGCAGTCGCGCACACTGAATGTCATTCAGAATCTGACGCGCTACACGGAAGTGGAGAAGTCCGCGCAACAGTCGTACCAGGCGTGGCTTGGCTTCTAC
AACTCGCACTCGAAGCGTCTGAAACTGAAGTCTGTGGAGCTTGTGCAGCTTGCGGCCGACTACAGCCGTCTCATCGGTCTGGATGAGGTGCCTAAGCTCG
AGAAGAggacgctcaagaagatgaacCTCCTCGGAGTGCCCGGTATCGAGCCGTCGCCGTACACACGCGACAACGGCGGAAACTTCACGGGTGGTCGCAA
TGGTGGTGGCAACCGTGGCGGCAACCGTGGCGGCTATGGCCGCAGATAAGTCATCGAGGTCGCAGCAATTGACCAAGTGAAGGAACTCCAGCTCGGACTG
AAGGTTTCACAGCAGAAGGCCAGGTGACTTCCTCATCATTAGAACCCAATCGTAATTTATTGCAACGAAGGATGAGTCGAAACGGCAACTTGACCATGTG
TATCCATGTCTATAACTGTAAATTGCTATAATCCTATCCTACCTCTTTCCCACTAACAGTAACGAAACgatggacgagatggcgaagaTGCTCGAGACGT
ACGCTGGCGGCCTGCAGCAGTCGTTCGAGTCGGTGTTCGAGCGCGTGGGCCAAAGCTTAACACAGAGCGCGCAGGTGATGCGCATGATGAACGAGGTGAT
GGAGACTGCCATGCTGCAGAACCTGCTCGTGTCCTCCTCCTACAACAGGAATGGAACATTCTTCATTGATGTAGAGAACCGCTCGCAGATCATGTTGGGT
CAGATGAAAATCAGTGCGCAATTGCACACTTCCGAGATACCTTTCTTCTCTACGAcgctcgagtcgctggccGCGGGGCAGCTGGTACAGTTGCAAGCTT
CGGTTCAAGACCTTGTTGGGCCAGTCGCGGGATACATCGAGCTGGAGTGCATCAGTCCTGGCACGCAACAGCCACTTACTAAACGTACGCCCTTCCACGT
GTTTTTCTTCCAAGGGGGTACGTTCCAAGCACTGGAGAGCGGACAGGAAGGCGCTGTACCTGATGCGTCGGAGGTGGTGGCAATGTCGGATAAGCTCCCA
TTGACACGAGTGAGGGAGATCCTGGATTTGAGTCCGATCAAAGGCATTTTGACGCTCCGGCAAGGCAGATATCGCTTCGTCCCAACACATGCAATGAGTG
ACACTATGTTTTATTTGTCGGtggaaggtggagaaggtgagTCTCCCTACAAAGTGTTAGTGCATTGTGCCGGAAGTGCTTCCAGTGCCGAAGATCGACA
ACGTCAATGCCAGCAAATTATCCAagagatggagctggactgCAACTAACGCAGGCACAGTCGTGCAATAGAACAGGTTTCGTACAAAAAGGTAGTATTT
CGGCATTGGGAATCTCTATCGCTTCCGATAATTCTTTGCTAAGCTTGTCTTCCCTCCAGCCAGCTGCAAAGACAGCAGCGCTACTTCACGCTGCCCTTTA
TCTAAGCTGCATTTCATCCTTTTTCTTATGCCCATTGGCGTTTGGAGATGTAACCGCGGTCGCTGAACCATTTGTGCAACAGGAACGACTGCGCGCCGTA
CAGGGCGCCCAGCACAGCCATCTCGAACACCGTATAGTAGATGATGCGGGACTTGCTGCTCTCGAGAGCtacacaacaacaaccaaTTGTCAGTGACAGG
ATCACATACCAATACGTTTGCCAACGAACAAACTTACTCTGAACATGGCGATGTACTCGAGCACGGTAGTAGTCCTGCTCGTTGCGAAtaagcttcagca
gcgttTGCAACCGAtccagcgacgtcttcgtgCCAACCATGTGCTCTGTAACGACCACAAgtaagaaaaaaaaaacgttagCTTGAGATCTAAAAATCCC
AAATTTACGTTGCACTCACCTTGACGGGTTTGTTCATCCAGCTTGTCCTCTTCACCCAGGTCATCCTCGTTAGACAGATCGAAAGACGTGTACCATTCGA
CCGTCCTAGACCTGCCGTCGTGCATGTTGTCGAGGCAGAAGCGGTACCATCCACCGCGGTGCTCCGActcgaagttgaagccgctgtGCTCAACATTTTG
GTTCATTTCGTCGTGCGGTGTCATCACCAATTGGTCGAAAAAGTTCTTGTCCACATTCTCCTCCTCCGGATACGACGAGAACGGGCCGAACGCCTTCAGT
CGCACGTCGTAGGCGCCCGTGGAGTCCAGCACGCCGATCTTCATGAAGGCCGTACGCTTCGTGCGCACGTATTCGTGGAAACACTCCTCCACGCGGCCAT
CCAGCTTCACGATCATCGCGTCAGAGGGGGTAGGGaccgccaccagcagagcGAGAGAGGCTGCTACCACACGCAGCAGTTGTCCGAGCGCCATCGTCAA
TGCCTGGGGTATGTCGTCAATCGGACAATGGGGAGTGGAGGTCTCACAAATCATCAGACTCAGTGACGAGGCCAAAAAAATGCTATTTTTAGCCAATCTT
CAGCCGGCTAAAAATAGCGACTCGAGTGACCTACCATTTTCGGCTCGGCATGTGGACGTCGCGCCGCCTCTCATCGCTCTTGACGCGCACGGCTAATAGC
GCTCGTGGTTTCCGCTCCAGCTGTGTCCCATGGGCCTCTTCTAGTGGTTATCTGAGCGACGTTACGTTTGCGTCGCTGCCTATTAGCCACGAGTCCAAGG
ATGTCTTGACGCGCGAGATGGGCTACGAGTTCTTGACGCATGTGCAGAAGGACACGTTGCCATTGGTGCTGGATGGACACGATGTGTTGGCCAAGGGAAA
GACGGGCAACGGCAAGACCATTGCGTTCCTGCTGCCCACGTTGGAGCGGATGTTGAAGAATCCGCAGCCGAAACAGGGCAAAATCTCGGCGCTTGTGATC
TCTCCGACGCGAGAGTtggcgcagcagatcgcAGTCGAAGCGGTGAAGCTCACGGACGCCCATGGACTCCGTACGTCTTGCTTTGTGGGCGGCAGTTCGG
TGAACAAGGATGTGAAGGAGCTTACGCAGCCTGCAGGAatcgacgtgctggtggccacCCCTGGAAGACTTCAGGCGCATCTCGAGGACAACAGCGGACG
CATCAGACAGAAGCTGGATAGTCttcaggtgctggtgctggacgaagccgacCGCCTGCTGGACATGGGATTCCGCCGCGACATTATGCGGATCATCGAC
CATTTGCCGAAAGAGCGGCAGACGCTGCTTTTCAGTGCGACACTGCCGACGGCGaccgaagagctcaaggaTGTGGCTCTGAAGGATAACTACACGTTTG
TGGATACAATTGAAGGCGATGACCAACAGACCAACACGCAGACGGTGCAAGAGTACGTCGTGTGCGACCTGCAAGACGTCATTCCCGTGGTGGAAGGCGT
GTTAGAGCAACACATGAAATTGCCGGCGTACAAGGTCATTGTCTTCTTGCCGACTGCACGGTCCGCGCAGTTCATGGCGCAGCTTTTCCAGGCTGCAGGT
TTCCCCAATGTGTTGGAAATGCATTCGCGTAAGAGCCAATCGGCACGTACCAAGGCTGCTGATGCTTTCcgcaagggcaagaaggtgatCATGTTCTCGT
CTGACGTATCAGCACGTGGTGTGGACTACCCAGACGTGTCGCTAGTCCTTCAAGTGGGCCTTACGGACCGTGATCAGTACATCCACCGGCTAGGACGAAC
TGCTCGCGCGGGTATGGAAGGCCGTGGCGTCCTGGTGCTAGCTGACTTTGAAAAGGCAATGCTTCGAGATCTAGCTGACCTGCCGCTCACTGAACTGGAG
CAACGTCCTCAACTGGATCAGCAAAACTACCGAACCACGCGAGCCCTCGCCAATGTTCGTCCTCACAGTGAACTGGAACAGTCTGCGGAGAAGGCTTATT
CAGCCTTTTTGGGCTTCTACAACTCGAACCTCAAGAAACTGAAAAtgtccaagacgaagctcGTTGAGACGGGTGCACTCTATAGCCAGCTCATTGGCCT
GGAAAAGGTGccgttgctgcagaagaagacgttgcgAGCGATGGGGTTAATGGACACTCCTGGCCTAACCGCCGCTTCCAAGCCAGTCAACGCACGCAAA
CCCAAGTCGAGAGGTCCGGGAGAACTGGAGAGATTCACCAAAGAAAATACGGGAAAGTATGCGTCAATTCACGGGCGTAAGAAACGTGAGGGCGATGGAA
AGAAGGGAAGTAGCTCATGGAGAACATTCAGTGGCAACGAAACCGGTCGCTCCCGTAGTGAACACTCGCACAAGAGTGGCCGTAGCACTCGTAGCGCTTC
ACCGAGTAGCACGCATGAAGGACGACCGCACAGACACTCGCgttctgcgtctccagcaaccAAGCGGAATTACAAGGAGCCGCACAAGAGATACTAAAGG
ATGGCAATCTCATGTGATAGATAAGTGGTGTACGATTGGAGAAGACtaagtaccggtacttgTAGTCTTCTGCAAGACCGCTGTAGACACTACATGCATT
TGTTGTTAGAAAGCGAACAGATCATAGTTCTTCTGCTAATACTACCTAACACTTACTTCGAAGAAAAAGGGAATTCCTCGCCTAAGTAATGGACTGGTAC
CTGGACCGCATTTGACGCTGTGCAGCAAACCATGTAGCGGAAGCTCCAATAACAGCACCAATGACAGCCCCGATGCCAATCTGAACGACTGAAAAAAACG
ATGTGTTCCCGCCACCGACAGAATCCTGCACTCCAAGGTTGGCACCGACATTTTGCTTACTTTGAaacagctgaagctgcttttcCAACTCTGGAACGCG
CGGTGGCACCAAAGTCTTACCTGGCCACTTGGAAAACTCGCTGAGCTTGAGCCACCACTCCGGATAACCTGGCATTTCCATTTCCTCTGGGGCTTCACCA
GTGGTGATGTAGCCGTCTGAGAACTTCCCCACTAGCTTCCATGCGAAAGACCACCACTCGTCTATTACTCGAGAAGCCAATCGGTTCGATTCTTCTTGCA
GATACATACGTACTTCGGCCGCTGACAGGGATTTCGTGTGAGTGACATGATGTTCCATGGCCTTACGCTCGGCAAAGCAAGTCTTCTGCAACGCAACCAT
CCGAGCTCGGATATCCTTGCTGATAGCGTCAAACCGAAGCATGCTCCAGTTGTTCACGAAGCTGAATGCCCACCAGGCTGATCCGTGTGTAAACTCACTC
TCCTTTCCGAGGATGTAAGCTGAAGGCACCTCCTGCTGCGCACAAGAGAATGGAACGTACACGGACGCATGCGGTGAACTTTGACCGTACCAAGCCACTC
CACCGACCGCATCGGGAAGATGAGCACGTGCCTGCAGCACAAAACTGAAGACCGTGCGATACATGGAAATTGGTCGTTCCCACCCGCCTACCACTCCTTT
TTCATCACCTCCCCACCGCATCGGATTTCCGAACGGCCCTGCTGCTAGGCCCTTGGACAAGTCGTACGGCGTACCTTGGAAATAGTCACGCAGCAAGTGT
GTCACGTCCGCTACGTCGAGGTTTTGGTCCGGCTCAACTGAGAACGGGTAGGTCGGAAACTCCGGGTAGTGCCCAAGACGGGAGTCCAACTGCAAGGACG
GCGCCACAAGATCAAATACGCGCCATATACGACGACCCATGTATAACGCACGCACGGGGTCTGGAGTTGGTGAAGCGTATGCCGCCGTGAAGTCGAACTT
GCCCTTCTTGGGTTCCCACCACCCCATTTCTTCAGCGAAGGACAGCACGTTCTCCGACGCCATGAACTGGTCAGGATCATCGAGATCCATTTCACGTATC
ACGAAGCCGTTGGCCACCACAACTACGTGCGTATCAAGCACTCGTTGAGCGGCCCAAACTGCACTAGCATTGTGCGGACCCGTCAGCACGTGGAAGACCC
ACACTTCTCCATAGCGGTCGGCAATACCCAGCGTCTCCGCTGCACTCACGTACTCAGGCTTGGCCGGATCGCCGCTGTCTTCGCTGTAGAACCCGTATTT
GACGGCAAGGTCACCCATCGTCTGGATTGCACAACAGGCCGAGTCGCAGCGTTCCAGAGCCACTTTAGTGAGCTCTCCGATGCCGAAGATGTTGTATCCA
TGAGGACCAGCATCAATGGGCCAACCCACCGTCCTGGCACCACTTGTGCTCTCTCCAATACTGAGCTGCACTTCGTTCATGAAGCCGTAGTCCTGGTCAA
AGTAGCCGTAGGTATGCGGCACCTGCGGAATCTCACCCAGTGGGTTCAtgaccagctcttcgttctTGGGCTGGTACTCGGGTCCTCGCTGGGTGCTCAC
GAGGCGCGGATAGCCCGGTTGCACGTTGTATACATGGCGCATAGCTCCTTGCTCGTGATCTCGAGCTGGCACACGCACCATCCGCAGGTCGGCAGCACCA
AAGCCGGCGTCGTCAGTGTGCGCCACCAAAGTGGAACCGTCGACCGTCGCGTTGCGCCCCACCGCTATCATCGTGCACGCATTTGCCAGCGGCAACAGTG
CGAGCAATAGCAACTGCATGAGGTTTGTTAAATGTGCTGTGCAGCAAGAGAAACTTGAAGTGATGCCGTTTGCCAAACGGTCGGATGCGATTTGTGGAAC
AACGTACCATTTAGAAAGGGTTCCAAATTCTTTACTTTTGAAGAGTGAAAGTATGTTTCTTTCGCATAAATAATTATTTGGGTTAACTACCATAAAATAC
GGGACGAACGTTTAGGCCATGAGGCGGGGTCGAATGGGGCCGATGGCCGTGTACGGCAGGGCACTggacagcgacagctcccGGATGGACGGCAGCTTGT
AGCCGCTGTTCATCTTTCGGGCGGGGGACAGCACAGGTAGGCTAAAGGTCGGCACCGGGTGCATCGGCGGGGACATGCTCTGGGTCTGATAAGACATGAC
TGGAGCAGCTACGATGACCTCCGCGGTGACAGCAGTGGGGCGTGGCAGAATGGGTTTGCACTTCTCAGCGAAGGTGGCCGACGCCATAGCTGCGCGCTTA
ACtgactgctgctcgtcatcgGCATTCGCTTTGCGCTTCCGCGACTTCTTGCTCTGGCGCTTGACAAGTGACATCTCGCTGAAATTATCGCGGGTGAAGT
GCTCCCGGCTGTAGGTGGGGAACTGGGCACGGGCCTTGCTCCACTTGCGGAAGCCAAAGTAGTTgagttggcgctggaagctcgagAAGTTCTTGTTCTT
AAAGTACTTGGGCAGGATCTGCGCAGCCATCGCGTCCTTGTCCAAGATCTGGAAGGCCATACCATCCTCGGCCCAGCGAATAATCTTGGGGTCCTCGCGA
CGGAGCATCtggtgcagatgcagcaagAACGGGGCCACCCAGCCGCGCTTCGGAGCCATCTCACTTGAGCTCGAAGAGGCTGAGCTGGAGGTCGAGGATA
CCGACACTGTGGGTGACGGCGGGCACTCGGGTTCCACCTCGCTAGAGAGAAGGTCTTGCACGTTCATTTGTAGTAGTGACAACAGATAGCACTTGCGCTC
GACAGGGCGGAATCGGAAATGAGACTGGCAGCGGAGCGCGTTTCTGATGGCAAGACGTGCGGCATACTGAATCCCTAATAGTTTTCTTTTTTTGAATCTA
GATTCGATTAACGATTTGATGGCTTGGTTTACTatctccagcacctctgTCGAATCTTGCAGCGGTTAGGTCTTCATGCGTGACAGTGTTATGGCCCGTC
TTTGCAAATATGGCATTTGAATCTCGCAAAATGTGGCAAATGGCATCGGCAAGCTGTAGCTCTATCCCTGTAGCTTTTCGAGGCCGTACGGGAGTGTTGA
AGGTGATACAGTAAATTGCATGTATTCGTACACCGTGATGAGGCAGAATTCATTTATGCATCCctgtacatgcatgtaccTCGCATGAACGGTATGAATC
ATTCAGTGTGGACCGGCTACACCCGGGGTTCCTTTTGCTATTGACGGGGCGAGTTCCCGATTTGTCGTTGGGATGGTGGAGATTCGCCGATTGACAGATT
CGCTGGCGCCGCTGCAAACTtgcgtgttgctgctgaacacGAATCTCGGGTTGGCTACGGAATCTCCAGTAGATTTTGTCTGGAAACCACCGCGAACCTG
CTCATGCCTTACTTATCCTGTATTCTTGGGCATTAGCTTTTCACATTTGGATGCCGCCCGTGTTGCCAGACCTCCAAGCACCAACGCTTCTGTGTTGTTA
TTttcgtcgctcttgctgcacCTGCGTGCTCTCGAGGTCAATACACGTACAGTACTTGTATAATATTAAAATTGGTATTTGGGATAGTTTGTCGAAGATC
CAAAATTTGGGAAATGATGAAGCCACATTTATTAGGATTCTTGCGATCTTGAAACGACGCAGTCAGCATCTTACCCGCATGGTGAAGATTCGGGTGCGCT
TCCTTCTCGGTACCGAAGCTCTTTGTGCCTCTAAGCTCTTGCTGCATCTAACATATTCACCCTCAGGGAATGTTAGTAGCTTCGTatcgctcgtgctgct
gctggcggcgaGCAGTGGGCAGAAATGGGCTCATGACACTGTCAACTCTGTGGACATCGGACTCTGGTTCCTCACGGTGTGAAGCCAGCGCCTATGACTT
TGAATCTCTTGATCCCGTTTGTTGACTCTCCACCTCTGTTCAGGGTACTGGCGTGCGCTACAAACTCATTAATGCTGGCGCCGCTGTTGACAGCACCGAC
GTCACGTCCGCGGCTCAGCCTTTCACGGCCtacaggagcttctggtaATGCCTAAAGCTACTAGTTACAGTACTAACTGCGCAAACTGACGCTCCAGCAA
GCTCTCTCTCAAGTGTTGCCTCCAGCGACCCGTGGTGTCTAGGGGATGCAACAGCCACAAGGGGATTCACAGTCTTGGCGCTTATCGCCGCCATCATGAG
CTTTATAGTGAGCATCATGGTGACTTTTGACATCAAAATTCCCACTTGGAATGGCGAAGGCAAGGAGATCACATTGGTCACTTCCATAGTGTGTTCTCTA
GTCGAGACGATGGTGCTTATCCCTGCTGTCGCGCTATGGCAGCGCATGGTCGCCGCCTACGACCAGCAGTGCCGCGAAGAAATGGGCATCAACACGTTCA
CATGCATCGAAACGGGCTCAACACACACTTGCGGCATAGTTGCGATcccttttgctgctgcaacttaTTTGCTCTGGCGGCTTTCGCATTCTTACTACGT
ACGCATCTTTAGTTTTAAATGCGCTGACCGTACCTAACTTCCATGTTTGGCAACGATCTGCTAGGAAGCAAAACGAGCAGGCAGAATTGCTGATGGCTTT
ACGCTAGCTGCGAAAACAGGCAAGAGAATGCTTACATACATTCGCCACATTACTATATCTAATGAGCAGTGCGTGCTTGTGCAGACAATGTTGACGAGAT
ACTTTCGGGCATTGCCAATAAGATCGACATCGATGCAAACGGCTCTGACGGCAGAAATGCACTGCATTGGGCTTGCACGTTGCACCGAACGAGCATTTGC
CACGTTCTGCTAAAGAAGGGAGCGTCGATCAGTAAGAAAGATGTGCGTTTGCTGTAAGAAGCTACGAGTGCTGGCTGGTTCTGTATTAACGTAGCTCGCT
CGCTGTATATCGCAGAGGGATGGCTGGACGCCATTGCACTGGGCTAGCCGAGTTGGCAATCTGGATATTGTGCGCCTTCTAGCCAAGTACGGCGCCAATG
TAAACGTACAAGACCGCTGGGGTACGACTCCGTTGATGCTGACGGTCGTTGGAGAAAGCAAGCTCGCAGCAGAGACGTTGATCGAACTTGGTGCTTCAGT
CGATGCACGAAATGTAAATTTTCATGTTAACATTACCAGGAAATGTATTGGCAGAATGTTACTGAACATGTGCAAGCAGGTTTTTGGGCAGACGCCGTTG
ATGCAGTGCGCTGAAGGAGGAACACCTCTTCACCAGCTAGGCATGGTGTTTCTTAATGCTGGATCCGACCTCACCTTGCAAGACGTACGTTCAAAAGGTG
CTATCATCGACATAATTGCTAAAAGTGATGTGCATTTATTCGTTTGCAGGCACAAGGTATGACCGCATTACACTACCCGGCTGCCTGCGGTAACTTCAAT
CTCCTGATGAACATGCTCCAGCAGTGTGATGCTGAATTGGTTGAAAAAACAAACAAGGTGAGCTGTAACAAACCTCGTGAGGTACGAATTATTGTCTAGC
TAACACGGATGTATGGACACAGTTCGGGGAGACGCTGGCCTACCTTGCTGTTCTTCACTCACACCCAAAAATATTGGACTTGATCGAGAATTGGCGAGAA
GGGAACCCCATTGTTGCAGTACACGACGATAGCAGCGACGATGGGGGTGACGACAGTACAGACACGTCCGAGGAtagcgacagcagcagcagcagtgaag
aaTACACTTGAAAACATCGCAACAACAGAGCAATGCAAAGATATAAACAAAAAAGCCTGTGGATCTATAAAGTTTGAACTATCTCCGCTCTATTGGAGCT
TCTCAAGAAGTAATTTAGTGCCCTTCTGCGAgtcgacgagcttcttcaggtctCCCATGACGGGCTTGAGCGCTTTCTTCACCACCTTGGTAGCGTTCTT
CGGGGCCTTTTCAGCCTCCAGGAACGCGAGGACCACAAAGGAGCCACGGTTGCTGGTCGCCCACTGCGGCAACTGCTCCTCGACGGCGGAGAGCAGAGGC
TCCGCGAACGAGGTTTCCTTAATCAGGCGGCGCAAAGCGTAGTGTCCATTGGCATCACTGTGGAGaggctcttcctcctcggtCGGCTCCGCAACTACAG
CGGTAGCAATGCTATCTGCCAGCTCCGAGCTCTCACTCCGCTTAGCGACCTCCACAATCACATCACGACCCTCCTTCGAGCGCATCAGGGCAGCAGCATT
CTCAGCACAcatctcttccagcttgGGCAGCAGACCCTTAAGCAGCTCCTCGCGACGAGCATCCGGATCCTTCTTGTAGTTCACAATCAGGACAGTGGCG
TCCTCAGGAGACGGCACCATGGGCGGCTCTAGCAGCTCCAGATCATCCGCCGAGAGGTACTTCTTGTTCAGAGGGCtaagcagttgcagcagaacCTTAC
GTCCGCTCGGGTGCATGGCGATCGAGAAAAGCTCATCGTTCATCTCCGCCAAAATGGACTTCTGCACAAGAACAGAGTCATCCACCACGTCGAAAATGCG
CATGATCACGAGGTAGCCGCTGGGGTGGTTGCacgcgtccagcaccttgtccttgagAGCCTTAATAATACGCTTACGGTCCTTGGCAGCACCGAGAGAA
ATGCACTTGTTCACGACACGCGCACCGTTGCGGGTAGCGAGTAGAGCCAGCGAAGCGTCACGTACGTTGGCCACCATAGCCACGACATCGTCGTGCTCGG
CATTGCACATGTACTCCCACAGCAGAGACTGCACAAAGGCCAGACcgaggagctgcttgtccaccaTGCGGTTCAAGATGGTGGTCAGGTGCTTGAGCAC
GtccgccttcttgtccgGGTGCGCGGCGATGATGTCCTTCAGGTTACGCTTGCTCTCAGACTGGAAGTAGGCGAACTCCCGACCGTAAAACTCCAGCTTG
AGCGCTGTGAGCTGCGACGGCTTCAGGTATTCCTGTGCGTACTCGAGAACGTTAGCAGCGATGTTGTGCGTGCCGATCTGCACGACGTGGCCGGTCATGC
ACTTGACAATGGCGGCACGGTCGGACACGCTGCCGTAACggatcatcttctgcaccaAGAAGCAACCGTActgcatcttggccagctcaATGAGgtgctc
cttcatctccaacaCGATCTGAGAGCGGTGCTCGGGCTTGCCGTGCTGCATGAGCGACTGGATGACGCGCGAGGCGTCGTGCTTGGCCGCCACGTCGTAG
ATCTTGCCCTTCACCAGCGTgtacagctcgtccacgagcGTGGCGCGCTTGGTCTTGTCCACGTCGCGCTCACGGATGACGTTCCAGATCTGCTTGGCGC
GCGTGACCATTTCGTAGTGCGGGCGCTGCATCTTGCGCTGtttcttggccagcttctggTCCATGAAGGacttcttgccgtcgtcaTTGCCGCTGGCGgg
gcgcttcttggcgttgaagccgcccttgttcttggcgtcgaagcCGCCCTTGCTGTAgctcttctccgtcttcgcctGCACCGCCATGTCTGTCACTGCA
ACCTGTTGATACTGTGGAGCTCTATGAGCAGTGGCAACCAGTCAATTGCAGTTCAATTGGTTACACAATTTGAACAGACCAAATGAAATTGGGAGGACTA
AAAACGTTAGATAGTCCTGTTTGAAGTGTGACACACAAATGATCTTGAAACGACGCGTCGCTTCAAGAGCAATAGCATTGCGCGAAGATCTGAGGACTGT
GAAGCATGGCCTTGTTCTACGACTATAATGTGGCGGTGCCGGCCAATCTGCGGCAGATCTGCTCGGTCTGGGGGGAGCTGGACCCTGTGCTTGCTGTCGC
ATTGGAGAATCGAGAGATTCACTTCTTCACAGATGAGGTTCGACACAAGACCAGTGCTAACATATTACAGGTGAATTGCTGACATTTCAATACTACATAC
TCCAGGGAGAGAAGCAACAAGGGCTGGATATCTACTCGCGCAATGCTGACATCGTCACGATGGCATGGCAACCTCGTGGAGGAGCACTCGCCGTTGGTTG
GAGCGACGGTACGATCTTAGGTACACCATTAGATAGAGTGAGCTACTAACCGAACTGTTCTAGGTATGGTCTCGCTGTGGGTATTCAAGGAACAGACTGC
TCGCGAGGTGAACTCTCCGCACTCGAGTCGTGTTTGTCTATTGACGTGGGCACCCGCGGGCAACCGCCTCATGTCTGCAGATGAGAATGGGATATTTGCT
GTGTGGAAGGTGGATAGCCGTTGTCAACTCACAATTAGCACACAGTACACGCGTCAGGGTAGCTTTACCCACTGTGTCTTTGCCACTCGATCAGCGCTGT
TGAAAGACAGCCACTCCAAAAAGTAAGCTTTTCTTTCAGCATTGGTAATAAGATGCCTAACTTGTCACTGCACAGTGATAATTTCTCCCAGCACGCTTGC
CCACAGTTCTTTTTCGGCGGCGAAGCAGGTTCAGTTCACTATGCAGATGATCTGGGGCACATCTCGGACATTCAAGTTCTGAATCACGCAATTGACTCGA
TGATGTTTTACGAAGAGCAGAACCGCCTCATTGTCATCACGCGCGCAGTTCAGCTTATCGTGTATCAAGTGGGAGCGACTGACGGCACCGTGAAGCCAAT
TACTAAGGTCAAATTGAGTttggctggagaaggttctCTTCTTGAAACCAAGTGGGCAGGCCCCGGGCTACTAGCAATCGCATCTGGCGAGCCGTTAGTG
CGATTCTGGAACATCCGCACGGAGGAGAACAGTGTGCTGAGCCTCCCCAAGTCAAGCGGACTCAACTACAACGTCAACAACTTGAGTTTCTCCCCTCGAC
GTCGCATTCTCGTAGCTGGTACAGCTCAGGGAGCCGTGTTCTTCTGGCGTGCCACCTCTTTTGTCGATGCATCTGCACAAGGCAACACCAACGCCGTTAA
TGTGTCGTATCGTTGGGATTTACTCTTCACGGCTGAAGTGGGGCGTGCAGTTACTCGCATCGGCTGGAGCAATGCACACCCTTCTTTGTATGCCAATACT
GTGGAAGGTTTGGTTATTTTGCACGAAGGCAACATGCAACGAGCACTTTGTGGAGATACAGCCGTCATTCAAGTTCGCCCCAAGACGCTTTCCATCGAGA
AGTTCCAAGACGGAGTGCAGTCTGGCGTGTCTATCACTCAATCGACGTTGGAAGCTTCACTGCGTGTCAAGGGCATTTCGCACGACGGATCGACCGTTGT
GGTTTGGAATGGCTCGAAAGCAGAGGTGTACGAGATGAAAGACGGAGATAACAAGCTCATTAACCAGTTCAAGTGCTTTTCAAGCTCTATGGTACTCAGG
GGCGAATCGATCTACCGCGCGAACGGGAACCACGTTGAAGTCTGCAATTTAGCTGGTGTAGTAAAGAACACCATCTCATTCACGGAAGCAGAGGGAAGAC
CGGCGATGTTGTCGCTGCAAAGCAAGTTCCTTGCAGTAGGTACAGATCGTGGGCTTCTACGTGTGTTCGACGTATCTCGTCGTGACCCGAAAGCCTTGGG
GAGCATGGGCAATTTATCTGAAGCTTTTGGTGACGAGACCAAGTCTGCAGTCATGCGATCGATATGCGTCAACTCAGACGGCACTCGTATCTGTATCCTC
GCTGACCGTGTCGAAGGTGGATTGCGAATGCGAGAGCCCATGGACAAGCTCTTTATGTTCCAGACCGATCTCAACATTTACCAGCAGTTCGACTTTGGGT
CTTCGCGCTACCCGGTATCCGCATTTTTTGACCCCCAAGAACCTCGATTACTCGTCTGCGAGACTGTAAAAACGGGTAACGATGGTGTACTCACCACTGG
TGGTGCTAGTCGGCGAGATTTAAATGCCGATGATGGTCTAGGAGGCGGTGCGGGTGGCAACCGAGGTAGCCAAGTCTCGGATAAGGAAATTACGATCATC
TTTGCGTCCAATGAGCACGGGCTTCTCATGCAGGATAGCTTCGATCTAGACCTCAAGTATACTGCGCTGCTCGGTATCCAAGTCCCGCGCGTGTACTTCG
TGGCTAAGGTGGATACTGGTTATTCGGATGACTCCACTACTGTAGTACAAGTTGGACGCACGAAAGTCAATAACCCCGTTGCGAAAACCCCTACAGCTTA
CGATACAGTGAGTTACCTTCGAACGCAGATCATGCGCGACTTCACGGGCTTGGACAAGGTCAACAGTGAGGCGAGGCAGGCTCTGATTGACTTCTGCTAC
TTTATGACGGTCGGCAACATGGACGAAGCTTATCGGTCCGTCAAACTGATCGAAAACCCTTCGGTATGGGAGAATATGGCTCGCATGTGCGTCAAGACAA
AGCGGTTGGATGTGGCTGAAGTGTGTCTTGGCAACATGGGCCACGCCCgtggagccgctgcagtgcaggaggccaagaaggagccgGAAGTGGAAGTGGC
AATCGCTATGGTGGCTATTCAGCTAGGTCTTCGCGACGATGCAGCTCGGCTTTATCGAGAATGCGGGCGCTACGACCTCCTCAACAAACTCTATCAAGCC
AGTGGGTACTGGAAGAAAGCGGTCGATATAGCAGCCAAACGAGATCGAATCCACTTGAAAACAACGTATCACGCATTGGCACGACACTATGAGGAAATGG
GCGACCTCAAGGAGGCAATGGAAGCTTACGAAGACGCTGGGACGCATCAGAAAGACATCCCTCGCATGCTTTTTAAACTGGGCAAGGTCGATCTACTGCA
GAAGTACGTGTCCACCTCCAACGACCGCGATTTGCTAATTTGGTGGGCACAGTTTCAAGAGAGTCAGGGTCAATTTGATAGCGCTGTGGAAAGTTACCAA
CGAGCCAAGGACTACTTGTCCATCGTCCGTGTCTTGTGCTTCAAAAAGGActtccaagctgcagccaaaGTGGCCCAAACGAGTGGAAATCGAGCGGCAG
CTTACCATTTGGCCCGTCAATTCGAAGGCCACGGTGAGGTCTCCAACGCCATCCACTTCTTCGCTAGTGGAGGATGCTACAACCATGCCATTCGTCTAGC
TAAGGAGCACCGCATGGACGCCGATCTCATGGGGTTTGCCCTTATGAGCAAGCCAACGGACATGCTGGACTGCGCTGCGTACTTCGAGGAGCAGCGagac
atggagaaggctgtCCAGCTGTACCACAAAGGAGGAAACGTTGCCAAAGCACTGGACTTGTGCTTCCAGGCTCAGCTCTTCGAGGAATTGCATCACCTCA
CGGACGAACTCAGCGGCTCTGGTAACACGTCACCTGCTATTTTGAAGAAATGTGCGGACTTTTTCATCGCCAATGGCCAGTACGCCAAAGCGGTTCACTT
GTGCTTGATTGGCAAtcgagcagtggaagctcttgatGTGTGCATGCAACACGACGTGAAAGTAACCGAAGAgatggcggagaagatgacTCCACCGAAA
GGCGACGACACCGCCTCACCCGCAGACAAGAAGAGACGCACAGAGCTTCTCCTAAAGCTTGCCAAGTGCTGCAAGCAGCAAGGTGCGTACCACTTGGCTA
CGAAGAAATATACGCAAGCTGGCAACAAACTGAAGGCTATGAAGTGCCTACTGAAATCTGGAGACacggagaaggtggtgtTCTTCGCCAATGTGTCTCG
GAACGCTCAAATCTTTATCCTTGCGGCCAATTACCTGCAGAATCTGGACTGGCGCAAGGATCCCGAGATCCTCAAGAATATTGTTGGCTTCTACACAAAG
GCGCGGGCTTtcgagcagcttgcagcCTTCTACGCTGGTTGTGCTCAAGTTGAGATTGAAGAGTACCGAGACTACGATAAGGCCATTTCCGCCTTGCAAG
AAGCGGTGCAGGTCGTGTCCAAGTCTCGTTCGGATGGAAAGGAGGCGCTACTTAAGCGCTACGAGAAGCGCATCTTACTCATTGAGCAGTTTGTGATCGC
ACGCCAACAGGCGAAGCAGAACCCGAAGGGGATGATGGAAATCGTCACTAAGTTACTGGAGGAACCAGGAATCGAGGAAGCTATTCGTGTGGGTGACGGA
TACGCCATGCTGGTGGAAGGTTATTATGAGGAGGGCGAGCTGAACAagagcttggagatgatggaggagatgaaacGCAAGGGACTGACACTCAAGTCGT
ACGTGGATCCTCGAGTCGTGGAAGCTGTTCAGGCGAAGCTTGGGGTTTCTCTAGGGGACGACAGACGTCGCAGACCCTCGCCCAGCGACTACAAGCagtc
gtcctcctccagtcgtCCAGGATCACGTGAAGCCAAGTCCAGTCGACCAGGATCGAGAGAGGCGAGTCGCCCAGGGTCCCGTGAAGCACATAGCAGTCGT
CCAGGCTCTCGTGAAGCAGCAATGAGCCGTCCTATATCACGGGAGGACAAAATGCGTCCTGGGGACGATGAGATCGAAGATGAAATGGAAGAAGACATCG
CTGAGGACGAGTAAGTGACGTCGTAACTGCAGGACTACGTACGTTTGAGTTAGCATAGCCAATTATGGACATATTTTCACTAAGTGTTCACCTTGCCTCC
ATTACATCTGAAACGAAACGAAATTCCCAAGATGTTGTTCGTATCTGAAACCTCGAGGCCATGCACAAAGCAATCGCAGGACCGACAGCCGTAGATGATG
CTGAAGCTACAGCGCTGCATCCCGACGATCCGGATTCAAAGCCGGAGACTGATTCCTCGACCGTTCAATATGATTCACTCAGCTGCATGACGCCATATCT
TACCTGCCAGCGATGCAATAGCGTCACGTTCATCGATGTGCAACGAGTGCGACGCAAAGCAGACCAGCTAGTTGCCTCCATACAGCCTCTTAACGAACGG
GAAGACACTACTTTTCTGTATGAACAAGTGCCCAAGTGTCCAGGCTGTGGGAGTACGCGATATCTGCGTGCAGGAGTCGTGAGTTTCCAGGAACagatcg
aggaggagcgaAATGCCATCAAGGAGTTCGAACGTCGACGAGTCCCAGCTACTGCTTTGCTCCAGCGTATCGCGCGTGGGTTCCTTGGGCGAATAGAGTT
CCGCCGACGGCTAGTAGAGCATGAGCGCCATCTCCGAAAGATCCATCGAGCGGCTACCAGAATCCAAACACGAGTGAGAGGCATGCAGGCACGGAGACGG
ACTCTCATCGAGCGGTGCCTGAGAGTAATCCGCTTTATGGCTCCACAGATCCTCAGCTATGCGTTAGCTGCTCGTCCGAATGAGCCACCGGTATTCTGGT
ACGCAAACGGCGCGGAGCTTGGAGTGTTTTATTGGAACTACAGGGAGTACGTACGACGGTCGGGAGGTAGACCGACACTGATCAAAGTGGAGACTAACGT
GTTGGAGATCACGAGGCGCGTCCTCCGTCGTGAATACGAGCTCGTCAGTCGGATTCAAGCGCGATGGAGAGGAATCACCACACGGATGGTCTTCCGCGAG
TTTAAACGTCAGAAAGGATGGCTCAAAGGCATTCGACAGTCTCCAGCCGTGAAAATTCAGCGTCTTGTCCGTCGTGATgcaagtcgtcgtcgctgtcgag
cATTGCAAATTACAATCAAGTACCCAACGCAACGCGAAGCCTATCGTAAGGAAATGGCGATCCGCGAAcagcaggcgaaggccaTCGCGTTCCGTCAGCG
TCTGATGGCCAAGTACAAACAACAATTCCAGATCAACCGCACAACGCGCATGATCGTGCAGGAGGTTAAAGCGTCCTCAGTAGCCAAGAAATACGGAGTT
CCTTCggcggacgaggaggatgcAAGCGAGTTGGGACCGGAGACAACTTCACACGTTCAACACTCACTCAAAAGTGGCGGAAAAGGTCTTGAGAACTCAA
ACGCGGTCAAATCTCAAAGCAAATTGAGCCAACTACCTCGAAACCCCAACGCGCTTCGGTTCGCCGAGATAAAACGTCAGCTCGACGGCAAGCAAAGCAA
AATACGCGGGCCAAAACTCCACATCCTCAAGGCGCAGATGTACACGACGCCCGCTGGTTTCTCATCCATGGACGATCGAGTGTCACCATAAAGGGTTAAC
CCATTCAACTTCAAGGGTGCATTTCGGACTTAATCGGAATGTCGCTGTGCCGCACACCAAGCACCAGGTGGTACAATTTGTACAAACCCTATGAATGCGT
CATTCGGCAACTTGCATTCACGCCAGCAGATCAGCAGAGAATGAGCATCGCGACAGGCGCCACGGAGTGCGCTGTGGTGGCCTTTGGCTGCAACGACGAC
GGGCAAGTGGGCACAGGCGCCAAGCGCAGACCGACTTTGGCCATTGACGACGTGTCGGCCTCCAATTTCCCCCAGCAGCTCGGTTGTCTGCAGGGCGAGG
AAATTGCCGCCGTCTCGTGCGGTTCTCGCCACACAATGGCGCTCACAGTCAACGGTGTTGTGTATTCTTGGGGCTGGGGATCGGTACGTGAAGCAGCCTA
TAGCCAATGCTTGCTTACCTACTGAATGGATATGCTTTTGTTTGGTTGGTTGGTGCAGATGGGACAATTGGGCCATGGAGACCTCAAGAGCATCAACGAG
CCCCAGAGAATTGCGTTCTTCGAGCAGGAAGGACTCGTGATTGACTACATCTCGTGTGGAGGCTGCCATTCTGCCGCGGTGGCCAATGACGGAACGCTGT
ACATGTGGGGCGAGACCCATTGGGGCCAACTTGGTCTGCccaaggagttcgaggctGCGCACGAGTCACTGCCAGTCAAGTGTCCGATGCCTGAAGGTGA
ACCTGGCGAGGCAATCGTGAAGATCAGCTGCGGTGGCACTCATACCGCTGCGTTGACGAACCACGGACGTGTCTACGTCTGGGGTCGAGGTGACAGCGGC
CAGTTGGGTATCGGTTCGGCGTGGCTGAAGGACACGGATGATGAAGGTCTTCTTGGAGTTAGCCGACCGCATCTAGTGGACGGATTTAACGGGGAGAAAG
TTGTGCAGGTTGCATGTGGTGCGTTCCACTCGGCTGCTGTGACGGAACATGGACACGTTTACATTTGGGGAAAAGAAGACTACGGCATGCTCGGTGTTGG
CCAAACATCCGACCAGCAGACTCCAAAGCGCGTTGAGTTCTTCGATGAGATCCCAGCGCTGTACGTTGCTTGCCTTACTTCTTTGCCGGGTACTGGAGCT
TTGTTGCTAACAGATGTGTTTTGTTTGGGTTTGTGCAGACGTGTTTCGTGCGGTGGTTGGCACACGGTAGTTGTCGCCAAGTCAGGAGCCTGCTACGCTT
TTGGACGAGGTGAATACGGCCGACTGGGTCTTGGCGATACAAAAAGTCGTACACGGCCACACTTGGTACGGAGTAGTGAGTGCTTTCAGTGGTACTATAC
ACCGTTAATTAACATCTCTGACATTTTGTaggtgaaggcgctgaagggACAAACGGTGATTCAAGCTGCGTGCGGCGGCTCTCACACCCTGTTCGTGACG
AGCGACGGCATCGCTTACGTTTCAGGACGACCCGAGTGCGTAACAAGTGTTTGAGCTTGCATTATCTTTGTTGACAGGGCTTTAACAGTGTGTATCCTTA
TGTTTTTTGCAGTCACGGAAGATTGGGATTGGCGGACATGAAGGCGTTGGCCGTGCCCACGCGTCTCGAGCTCGGCTCAATCCCTGTTCGCCAGGTATCC
GCAGGTGGCGCACACTCTGTGGCTGTAATGCACAGCTCCCGCCCCATCTTCTCGCCAATGATCTCTCCGCTTCCTACCAACACACCAGTCCCGCACAGCG
AGCTCTGATGGACATAAAGCTTAGAActggaaaaaaaatacaaacCCTCTTTGACTTGCActacaagttgcagtttATCAAATTCGATAGAAAGTAGCCA
TATCATTTTCGTCAAACTTGAAGAGTGAAGGTCTCACTTCGCTTTTCAGAACAATGAGCGAAGACGCCGCGTcctcaagctccagccactCGCGGGACCC
CAGCTCCAGCCCCGCATGGCTCTCCACACAGACTATCGAGCGGTCATCTCGACACAGTATGCTCCGCACCACCGAGAAGTCCGTCGTGTTTCGTATGCGC
ACACAAGAGAAAGTATCCGGGAGTCGAGGGGGAAGACGATCCCAGCAGATGTTCAAGCGGGGAGATACACGCGGGACCGACGACAGAGACGTCAATGAGA
TGCTGACGGAGCtgtacgttgaagtggaggcgaagaagcagtggctgcaaagcgaggaggagatgtttgaacgaggccaagaacgcTTACAGAGCTTGAA
ACGACAGCACGCGGAGCTTTTACGCACGATGGACCAGTGCAAGCGACGCAGGAAGGAGAGAGTCAATATCCGGGAAATGCTACGAGGAAATGAGGACAAC
GGTGGAGCCTACGAACGGAGGAGCAGCATTGACAGCAGTAGTGACAGCGACTACAGCAGCTACCGTTATCAAAACAGGAGCGGTAGCAGGCGTCACCATC
GGTCACGACACGACGGAGTTAAGAAGGAGCGCAAACGTCTACGCCGATTCCAGAGCAAAGTATCCTTACAgttccaactgcttcagtcCGAGTGCCAACG
CTCGAAGCTGGAAGTTGAGAAGGCGCTGGCAGAGGTCCGAAGCAAGTACGCGGACTCGTATCTCTTCGGCAACTCGTTTTCTTTTTGAGTAGTTTAAACG
GTTTAATGTCTAAAACACATCTAATACCCGTTTCAAATTCGTTTCGCGCCAGCCAATCAAAACGCTTCCCTCCTAAAACCCGCTAACCTTCAATTCAATC
GAGAAGAATTCGATGTGGGCGACCCAAGCCGGgctcgaggacgacgacccGCGTGagatccagcgccaacgcgaGGCTTATGCGAGGGAACTAGACCACC
AGATCGCGCTGCGTCGTGcgcgccagcaccaggagcaGATGGAACgcgaggaactggagcgcAAGCTGGCGCCGAGTGAACGTTCGCCGTCCAAGTGGCT
AGTCGAAGGCGGCTATTTGGACCCGCCCGCGGCCTCTCAGTCGCCCTGGAAGTTCTCACAGAGCGTGGATCTACAGgacgagcaacagcaagaccGAGGA
GCTGCCACGGGCGAGGCGAACAGCGTGTCATCGTCCCATCCGCGCTTCCGAGTGacggacgagagcgagacCAGTCAAAGACTTCGGGAGCGCGCACAAC
AGATGCAATGGAAACGGATTTTGGACGAACAGGTGCAGGAAAAGGCGCggctgaaggagcagcaagaagcggagcGCCGACGCAGTGAGGAGGACGCAGC
TAAAGAGGAAGTGAGGTACCTTCGAGAACAGCAGATGCGAGCACAAAGACGTCTCGGGCAGTTCTCACCTGCGGTCAATGCTGAGGCTTTGGATAACAGA
GTGGAGATGAAGTTTCCGTATCACACACTGCCATCGCCGCCGGAATTGCCGACGAATAGACAGAAGAACGATTTCCAACCGACAATCCGACAAAACTATG
CATTCCACAATGATGCAAGGGAGGAAGAGGACAGGTATCATCAGAGGGAACGGCAGTTTGAAGATCACGCAACTGCAGAAGTTCTACTTCCTCCGCCTGC
ACCGACTCGGATTCCGTTACATCAGCACAATGGGCACAGTGATTCGAAAGATGACATTCGAAACACATACGATCGCAACACAATGAGCAGTGGTATTGCT
GCAAGACAGCAGCATTCTCAGGACAACGATTCACAGGCATCACGCCTACAGCTTGAGCAACAGAGCCGAATTATTGAGGAATACCACTCGCTGCTGGCAG
AAATCCGCCGTGAACGTGAGGAACTCCGGAGAGAAAGGGATGAGGTGCGGCGTGAGAAGGAGGAATTGCGCGTACAGAGAGCTTTAttgcagctggagaa
tgAAAAGATGGCCAGTCTCGTGGATGCTCAACGAGCTCTcaatgagcagcagcaggcggacctacagacgcagcaggcacaacaagcgcagcagcaggcg
ctgcagcaagccCAACAACAGCAATACCAGTCTAtttcgcttcagcagcgactATCACCCGTTCAGCCCCCGGACTTTGCTAATGTTCGCAATGGTTTCG
AGCTTCCAGATCACCAATACGCTGCTTCTGAAGCTCAGGCTTATTCGCGACTGGACCAGATTCGTCAGACGCTTGGCGGCCTAAGTatccacgacgacca
gccCCAACCTACAGTGCAGGGTCGACGGAGAAAGCCGCCAAGTCCGATGTCCATGGCAGATTTTTCGGCGCCCACACCTCAGAAACGCTTGACTGTCAAC
GCTACGGAGTCTCCGCGTTTCCAACGGTTATCACGGTACAGGCCGattccagcagttccagacgACGAGAGCATATTAAATCAGTCTTTGACTGGTGAAA
GCGTGTTCGTCCCGTTGAGTCCCAAATCACAGAATCAAGCCAACAATGGGCCTGCACCACGAACGACTTCCTCTCCAACTTCTGCAACCAGGCAGGGGGA
CAACCGCCGTGTGAATCCCATGCGAAGTAGCCGCGTCATCAAGAGCCGAGGCTTCTACGActtcgagcaggagctcaagagcgacgaTAGACTTGACTCG
CTCGCTAGCGGATCCATTCGTGACAGCTTCGGCTCAGACCTCGGTAGCAGCTTATACGGAGACGACGAGGTCGAGGCtagtgatgaagacgagctggacg
agcaaGATAATCACAACGGGGACTCGCATCtagcagccagcagcagtctgTTCCAGGTTCAAGTTCTCGTATGAGACTCCACCACAGAGCTTATAACAAT
ATATGTATTATTTTCATGGGTAAACGAGCGtagcgaggaagagaacTCCTTtttggttgaagttgcttttTGCGCGCGTCACATTTTTACGTGGTTTACA
CAAAATCGATGGTTGGCGCAATTTTCTCCTCAGTTGTCTGTCATTCGTTAGAGTCCAAGATGACGTTCCAGTTCCCCGTGGCTagcggcaagaagaagaa
agtgcAAGTGTTTGAGTGCCCCACtgagagctggaaggagcgCAAGCCTCGTGCTACCAAGGTGCATGCTTTATTGTTGCATAATTGACCCGATATTCCA
TTGGTTCTACGTCTGACACACTCTCGTTTTGACCAGAATAAAGCCAAGGACGATGAGCCTGAGATGACGCTGCGTCAGGAGATCCGcaaggagttcgacg
acACATTCGACTCGGTGTTGGACTTCGGTGCGTAGTTCTGTTGGCTTGGTGCAAGTTGCTGCGGCTAGAGACACTGAATTCGTTTGGTTGTGACAGCTAC
GTCGAATTTAAAgggcaaggagaagaaagctcATGAGGCGAAGAAAATTGAGGCACTTGGCGGTAAAGCTGCCAAGAATCGCAGTGTGCCTTACAAGATG
CTTATCGGAATGAAGACCAAGGGTGCAGTCAGGAAGCAACGTCGCGAGGACTTGGTATGGCTGAGATGCAGTTTTGTTTTTATTCAGTGGTGTTTCTTGT
CTGCAGTTTCTAACTGTTTGCACTGCaatcggtgctggtggtggtgaatTTTTAGCTGAAGGAATCGGATGTGGTGACGGGCAAACGGAAGGCAAGCGGC
AAATCGATagaccagcagaagcgcaagaaggtTGACTTCGGCTTGCAGGCTACCAAGGGCAGGTTCAAGGGCGGCGTGCTGGATGTACGGGGTCTGTAAA
AATATTGTTACGCGGAATTCATTACTGAACTCTTCAACACCGGTACCATGTACCACTCTCCATTCGGATCTTTTCATCTTTTTGAGTGtcacgatggagg
aggagaccaagacgcGCTTCAGTGAGGCCCTCTCGTTAGCATTGACGGAGTTGCCCCTCGTCTTAACACGGTGACTGCATCAGCTTTTTCCTTTTTCGAT
GCAGCGCATACCGATGGCTACGTCCCGCCGAGAAACGACCCAAAGAGACTCGCTGACAGTCAGTTGATTTCACACCAACAGGGAAAAGGATTCTTCtctg
aggaagaagaaaacgagTAGGTATTCACTAGTGTAGCTCCTtgtgatttttttttttatctcCATTGCGTCTTGACGACGAGTGCTGATAACAGAGATAT
CGTGGCAAAGATCCACCGTTGGAAGCagtccaccaccaccaacgaGAGTAAGACAAAAACTCCGCTAAAGCGTCAAGAACTGCACAGTCTTTTCGCTGAT
CCCATGAAAAGGAAAGAGGTACGTTGAACGCAAACCTATAAAGGAGGCATTGCTTTAGCTCTCACCATTTTTGATACAGAAGTCTCAGCCGCGGGCAGAC
GACAGTATCCCAGTTACACGTGACGATATTCAGCTGAGTCGCCTACTGTATGCATCCGATTCCTGCAAAATTGACGTTATGTTACAAACCTGACGCGAAT
TCTGCGGATACCGTAGGGATGACTGCATGCTTGGAGACAAAGGGGATCGTATCATGCAGCTGATGGAAGATCTGACCACGAATGACTCACCACCGTCTGA
ACAAAGTTTAAGTCCGCTGAAGAAAACAGAACAAGAGGAGCCACCTGTGGACTTTGACGCGTTGTTTTCAATGGAGGACTTCGAGAAATACATCGCTGAA
AACTAAATACGCTAATATATTAATGTTGGGCACAAACCAAGTGATAGAAGTACTACACCCACTCGTACAACGCAATCACCGATGAACGTGAACGATTCCG
GTGCACAACCTGCTGCTTTCGGATCCATTGTCGGAACCCAAAAGTCCCATCTCCACCGATGGACTCGCGCACTTCACTCTCAAGGTCGAGATCATCGTCA
ATCACAACACACGACCCACGATCGCTTAGGGGCATCGCGTCCGTTTCGCGGGGCTCAAGCACCAGAGATCGAGCATAACGGCTTTCTTCTGATGAATACG
GCAGTGAGACGTGCAACAGTTTCTGCAATATCGAAGCACGCACAAGTCAGAATTTGCACGGAATAGCAGTTGGTTGTATAGCTTACGTCAATGTCCTCGT
CGTTCTGGAGAGTGTAAGCAACAGACTGCCGATGTAAGATTTCCATCGACAGCTCGCCCATTCGTCGCAGCCGGTTCGCATTCACCATCCCCTCTTTGTC
GAATGCAGGCAGCTCGTTCAACCCGACGAAGCCCTAAAGCACATCTACGGCGTCAGATAGATTTCACCCTAAGATTGTGACGAAAGTACAGACCTGGAGA
TACAAGCCGATATAAGGCATGCTTGGATTGGCAGTCTTGCGCATCAACCGGTTCATTTCGCGACACCCTTTGTCCGAGAGTAGTTGCATCTCGTTCATCT
TTTTCTTCGCACCGACGTTCAGCTACAATATAAAACCAATAAGGTCAGGAAAGGCTGGGCATTCTACTAGCATGAGCTTCGTAAACGTACACAATCGATG
GTCTTTCGAAGCCGCTGCACTGCAGTAGATTGCAGCGCATATAAAATAGCAGCTAGAGTATCGTGGTTGTGCAATGACATACAATAGTCGGCAGCCTGGT
CATTCATAATTAGTATTGCGCGTACACAAGCATTTCCAACATTTATGTACCTTGAGGTAAAACGAAATCACTTCTGCACGCTCTTCAGGGGTGTTTTGGA
CCAAAACCGCGTTGATCACATACGCAGAAATCTACAACATCAAAATTGTCAGAACACACTTCGTATCAACTTTCCGGTGGCAACGTACGTGTTGGAACCA
TCGCTTGATGCTGATGAACTCAACTAAATGCTGATTTTTCGAGCTCGCCGAAATAAAATCTTGGACTGTGGTTCACAACAAGGATCAGTTTCCTCCTTCA
CAACGATAACACTGTACAGAAATTAAACTCACCTGGGATTCTGCAAAAGACGGCGTGTGTCAAAAGCGTGCATTGCTCAGCCCACTGCTCTGCTTCGATA
TACCTGATAGTAAAGTGATAACACTCGTTTTTCAGTAACGCTTTAGTCAACACAAATGAGCTTACTACTTACCGATGCAAATGCATAGGGAAAGGCTCGT
TGGAGACAGATTCAACGCCCGAGTCTGGACCGTAGATCTTGGTCATCGTTTTAGGAATCACCTCGTAGTTCATCGCATAGTTTCCAGCTCCCCGAAGAGA
AAAGTACTCTTTGTAAAGAGTGGCGTACTCATCAATCAATGGGACGAGCTTTTCCTTCGGGACGTCAACGTTGTAGCTAATGAGACCGTAGAAGCGGTCG
CGCAGGTCGTCGGCTTCCTTTGTTTCTGACTGCCTGAACAGCAGTATCATGATAAAGAGTCGAATAAGTCCGTGGCCTAGATAAACACAACGCAATGAAA
TTAGTGTTTTGTCTGCAATTCGACTCTGTAGAGCCTTTGATACTTACTTTTGATGCCATTTCGGAGATGCTCACTTAGCTGATCCACCACTTCGTTCAGG
CTTGAAAAGCTGTCCAAGAACAGGACAAAcgccaccacgtccaccaAATCAACTTCCACACCGGAGACCAGATCACGAATCATGTCCTCAATTGTCCTCG
AGTGCACAGATCGTGAGGCGCAGTCGTTCTTGTCAGTAATCTTCCACGAGTTATGAGGCATTTGAGCACCCAGGTATCCCGCAACCTTGTTCACCTCGAT
GCGGTGAGTGTAGTCGACAGACGAACACCCAAAGATGTCCACATCAACACCGTTTCCTCCCCGATTCAGCGACCCCAACTTCCGCAGTAATCCGACCACA
CGAGAATCTCCTGAGATATTTGCCAAGTGTGAAGCTTGGCGACCAAATAGATCGCGTTTGTCTAGACGACAACCAGCACATGTCAAAATCTCCAGGCATA
AAATTCGACCACCCCCATCGACGCCAGAGGCGGTTGCAAGTAAGACTGTGGCTGGAGTTTGCCCATACCGGTTCTGAGCGTTTGGGTTGGCGCCACTTTG
CAGTAGTCGGAGAATGATATCCGTGTGAGCCAAGGCGGCTGCAAAGTGCAGGCTGGTGTTTCCGTCTAATGTTGGCGCATTCGGATTCGCTCCTTTTGAG
AGACAGAGCTCCACAAGCTCAGTTCGCTCACTCTTGACTGCAAATTCCAGAGCTGAATAGCCATTTGACCACGCCACACGGTTCACATCAGCCCCCAGAG
CCAGTAACGTCGCCGAGCCTTCGAGAGACGATCTGGAGCACATGAACATCAGCGGAGTAAGCCCATGTTTCTCCGCTGCATCGATATCAGCTCCTGCATC
GATTAGACTTTGTATGATCATCGCCATATCGATCGACTGTTTCACAACGTGCAGCGGTCGCCTTCCTTTGTAGTTGCACAAGTTGGCATCTGCTCCCTTC
GAGACCAAATAGTTGACCATTCCGAGTTGTCCGTTGTGCACAGCTGCATGAAGTGGAGAGCCTTTCCCAGACACGGGAACAAAGCCGAAAACCTGCATTC
CACGAGATTTCTCCCACGAGCAAAGCGTGTTCAGCTCCATGGTCGAAGATCTTAACCAAGCGGCCGAGTCCAAGTCTCCACGGCGAGCTGCGATACACGT
CAAGTAGCGGGGCATCTCCAAGTCCAGCGTCAGCAGTTGATAGTAATAGAACTCGGTCATGAAGGTAAGTTGTTTCGGCAATGCTGCAGTTCTGACGCGT
TGAATAATCTTTTCGAAAGGCATCCCAATCACAGGTTCGTGGTTGATCGCGATCAATGAAAGGCCGGGAACGATGGCGGTGCTCAGCGCTGCTTGCGACA
GCTTACGGACACTGTACACAATAGCCCCTCGCCCGTTTCCATCCGTCGTGAATTGAATACCAACGTCATTGGTCGAGATGGACACTGAAACACGGGACCC
TGCGAGAGCCATGGAGTCAAACTGGCAACTTTCGTCGCCGGTCTCGAAGCACTCGACCCACTTGATCGCATCGAGAAATGCTGTCACGATGTTCGCCTTG
TTCTGACACGCTGGGTGGTGCTGATAGCCATACTTCAGCAGCGCCCGAACGATGGACAAGTCacgcagcgacgacatcgtAACCACGTGCCGGAAAACCG
CCGTCAGCGCCTCATCTGTAACCTCGAAGAGCTCTCCGTTAACCTTCGCAATTGCCTCCATGATGGCCTTTCCGGATGCTAAAATCACCTCAAACTTGTG
CGTAGGTAGTGAGACACAGTCGAGCATATTAATCACACTAATCGCTTGCTTCCAATTGCAAACTGACAGGTCTTTCGAGACGCCGAAATCTGCCTGtgcc
ttctgcttcaatACCTTGATATTCTGCTCGACCTGGctgcgcttcgacttcatttTGTCCGTCTCAAGGCTCGCGTAAGCTTCCGTATACAGCGCAATGA
ACACACGGTCTTCCACGTGTCGACGGATGAGTCGCACCAGGTCATTACCGGGCAACAATTCAATCTCCGGGTCCTGATAAAACTCCAAGTGGTGGCGATC
AATGATGGCGTCATCCAATTCCACAATGAAGTTGTGAATCGCCGCGTACGAATGGTCCTGCTCAAACTCCTTAAACTCCACCAAGCTCTTGGCGATCTGC
TTGTCCGTGATGAAGATCTTGTTTAAGTGTCTGGTAACTGCATTGGAGCCCGCTTTCTCTTCAGTAGCTGTCAGATCCACCTCGTAACAGGGCGGGGCTA
CTCTCCTCACCGACCTCAAAGCAGTGACCCAAAGCTCAGCTTCAAActggctgcagcagtagcaCAGCAATTTGTAAAACCCTTTTTCAATCTGGAACAC
ATAGGCTTTGTCCGCCACGCGGATATCCACATGTTGTACGGAAACCACTCCATCATTGAGCTGCATACACCCTTTAATCTTCTTCCGGCCTTTGTTCTTG
TAGTAGGCGAACGTGCCGTCGGAaaacagcacgaagaagcgcgtcttccagctcttccacatGTGGCCCTGCTTCGTGAGCCACCCCATCTTAACAAAGT
TGCCTACTTGCACCTGAGTCGCGTAGAAATTATCGTTCAGAAGCGGATCGGAGCCGTGACGCACCAGTCGAAAACCTTTTTCTCTCTGTACGAGAGTCTG
CGGCGTCTCCGAGGCATCAGATGACGAGCGCAACGTTCGCAACAGTGGTCGGTCTCCAAACATGGAGGCTAGAAGGCTGCGGCGCTTGTCCCGGTCTATC
TCTTCCGTtgcttcttccacttccagctccacgtgccgcgcctgctgctgcgcgaggcTCTTGGCGCGTGTACTGCGACGCGAGAAGTGCGAGCGCTTGC
TGACTTTGGGAGCCGCCTCGTCCAGAAGCGCTGGTGGTGATGACGGATCCCGGAAGGAGCTTTTGCTCTTATGGCGCCAGCGCGAAGCCATCGGGTTTTC
TGTAGCTGGCCCTTTGATGCAGAAAAAAAATTGGCTGTTTGACCTAAGCGACTCGTCACCTAgcctaaaaaaaaaataattcCGCTAAAAGCAGCTGTTT
TCCAGCGGTAGAAGTTCAATTTTGACGACAATGCACAGGTAAATGTGGGACGGAAACAAGCGCTCATGCAGAGAGTTGATGGAAATGAATGCACAGTGTA
TTATGGAACGTGCAGCATGGGTAGAAAATCCACCTACACTATTTTCCTGCGTTGGACTGATGGCTGCATTCGCTTCGCTTCCAACATGCGTGCGAGTATT
GTGGATCAACCAAGCACTGCCGGCAAGTGAGCCCCCGTGGGTTAACTCTACCCGTTGGCCAAAACCATTGTCGTTTCGATGCCGTGCTTGACGAGGAACT
CGACGCTACGTTGCCTGTGCATTGCTAATGAACGTCGCTACGATGCAGGCCGGAACACGAGTGGGCGACGTGCGCAGTGAAAACCCCGCAAAAGCGTCCT
TGAGGCCGCGTAGAGGAAGCTCGCCATGCTCAACAAGTTGTGTGGCAATTGCCGCCcagctggcgttggcgtccgCATGATCATCGATGAGTcagcgctg
cttccactttgcggctgcagcagtacaACTTCCACCCTTGGAGTGGCAATACCGGGCTCTCTGCCCTTGCCTTCTCCATGAGCAATGACTTATTTTACCT
TGCTAGAGAGAAGCCGTTTCGCTGTGCTGCCGCCACCGACGGCGAAAAAGCTTGATGTATCTATCATAAGCAGTGAATGTGGAAACCCAGTCAAGTCTAT
CTTCAACACAAGCACTATGAGCAAATCCCCACTTCCGACATGTCTTCACCAGGCCTTCCACCTTTATCTAGTGTTCAAGTTGAGCAAACAAAGTATCGCA
TGCTCAATCAAAGCTACACTGTAGCAATGCCACCAAAGTGCAACGACAATTGCCAAAAGTGACTTTTGGTATGGTAATACTTGAAGTAGTTCTTCAAGCA
GCATCAAAAACCTGCCATCGATAATGtcgtgtgcaccacatcTCCCGGATACTTACATGTACGGCTCAAATTGCTTGTCAACCAGATGTGGGCGGTCTGC
ACGCGTCGCAGTTCCTTGGCAGCTGCAGGGCGGAGCCTCTCGACGTCGCAGTCAATCCGCACTGCTCCCTGCGCCTTGCGGTCCGTGCTGTGGGCTCCCA
CAGAGAAGCAGGCGCCTTCAGACGCGGCAGTTCccagccaccagctcctggtgcgCGCTGGTTTCGTGCGCAAAGGTGGTCATGGTCTCTTCGCTCTGTT
GCCGCTGGGCCGCCGCGTTATGGCCAAACTGGAGGCGATAATTGACGACGAAATGTACAAAATTGGCGGTAATCGCGTGGACTTGTCGGTACTGACGCCC
AACGAACTGTGGAAGCAGTCGGGGCGTTGGCAGAGTCGCGGGCCTGAGCTTATGACGCTCGAGGACCGACGCGAAGATGTACTTGTGCTAGGCCCCACGC
ACGAGGAGAGTGTTACGAGCCTCGTGGCAGCTCATTACAATGCAACGGGGGCGACGAATTCGTCTCTGAGACTGTACCAGGTCGGCCGCAAGTTCCGTGA
TGAGATCCGTCCTCGATTTGGTCTCTTGAGAGCGAGAGAGTTTGTGATGAAAGACATGTATTCGTTCGATGTGTCGTACGACGGTGCGTTGCAGACGTAC
CAGGACGTGACAGATGCGTACAATGAGATCCTGATCTCGAGACTCAAACTGCCGGTGAAACGCGTGGAGGCCGATTCAGGGAACATTGGTGGCAATCTGT
CGCACGAGTTCCACGTGCTGGCGGATATCGGTGAAGACGCGATTCTGTCCTGCTCGTCGGAGGAGTGTGACTACGCGGCTAATGTGGAGAAGGCAGAGGG
GTTTCTACCTCAGATGCCGATGGAACACAGCGGTGAAGTTTTGCCAGGGCTGAGTGCCATCATTGCGCGGCTAGAAAGACAAGCTCTTGCTGGTGATTCT
CAGATGTGGACGACTGTCATGGAGCTTCAGGAGGTTGCGCGGTCGCACGGTTTCTCCGTTAAGTATGTACACGAGCAGGATGATCTGGCGGATCTTAAAA
TCGATGACCTCGAGACCAGAGCGCAGCCGCGTGTAGCATTGTGCTTTACTCGACATGACCGCGAAGCGAATGAATTGGCTGCCAAGCCGTTTATTGGCGG
TGATGAAGGCGAGGTGGTCACGAATCAGGCGAAGATCGCCGACCTGCTCGGTAAAGCTAATCCGAATGCTGAGCTGCATTTGCTTCTGGATGATTCCCTA
AAACAAGGTGATCAAGCCTCTCCAGCTGTGGAAGCTCTATGCGACTTTGCAGAAACGATATCAAAACAGCGTGAGAATATTCACCTAGTGTGGGGACACT
TCCGCTTGGCACAAGCTGGTGACTGCTGCCCACGCTGCAACGATGAGAACGCAGTGCTTGAGGACAAACGCGGTATCGAGGTTGGCCACGTTTTCTATCT
GGGACAGAAGTACTCGAAGCCTTTTGGCGCGACGTATACGGAtgccaagaacaacaagcACCCGCTAGAGATGGGCTGCTTCGGTCTTGGTGTTAGCCGA
TTGGTTGCCGCGGCAGTCGAGGCATCACACGACGACCATGGTATTGCGTGGCCGACTGAAATTGCGCCGTACAAGGTTCTTGTCATGTCCATCGGCGGCA
AGAAGCGAGAAGATACCGTGTCCCAAGCTGCATGGGATATTGCTGACAAACTTTCATCCGGTAACGTTGCCGGCCTAGTGAAGGAcgatgtgctgctgga
cgatcgCTGGCGAGAGAGTCCTGGCTCGAAACTGGCCGAGTCGGAGCTCATCGGATACCCCTACCGCGTCGTTGTGGGCAAGCGGTTCACGAAGGAAGGA
CTCGTGGAGGTACAGAAGCGAGCTACAATGGAGAAGACTTTCTTGGCTCCCGATGAGCTACCAGCATTCTTCGCTAAGATCGTTCAAACAGGCAAATTCT
AGCTGTAGACG