Description :
From Genome Similarity Track
Location :
Scaffold_6:109969- 117416
Transcript NameFunction/comments
Phyta_totarag461hypothetical protein PHYSODRAFT_349212
Phyta_totarag462hypothetical protein PHYSODRAFT_552366
Phyta_totarag463hypothetical protein PHYSODRAFT_552363
Phyta_totarag464hypothetical protein PHYSODRAFT_537335

Sequence
7447 bases(100 bases per row)
CTCACTGATACCAATTTTGTATCAGACGCATAATTGATCTTCATGTTGCAGCGAAGCAAGGTGAAGGACGACGGCGCGGCTGCAGGCGCCACCGCCGCGG
CCACCATCTGCGAACTGTGCGACTTGTATACGCGAAACGACCTGGATGGCAAGTGGGCGGAGCTTGCGGCAGTCTACGACGTACGTTTTACTTCCACTAA
CGTTAGCAGCGCTTGCAGATCCGACACTCACTGTTGATTGACGACGTCCACCTCTGTAGCAACGCCGCAACGTCGACAACTTCCGCGAGATTCTGGATCT
GAGCGCCCCCAGCTCGCGGATGGGCGACCTGAACGGCTGGCACCTGGAGCGCATGGCAGTGGGCGAGTTCGAGCCTGGAGCAGGCGCCAGCGCGAACGAC
TTGGCGGAGATCAAGCGTGAGAGCCGCCTGGTCAAGCAGACGCTGATGAAGGTGATGGCCAATGGGCGCAGCTTCCAGGCCAAGCGAGATGAATTGGAGG
CAGTTatggccaagcagcgtgAGGCGCTGACGGTTGAACTGACGGAAGCCAAGGAGTTCCTGGGCCAGGCACATCTGCTGAACGCCTGCGACTCGGCTGC
TATTGAGGTCAGTGAGCCGGCACCTGTGGAAGAGCGACTGCGCGCCACAGTGAAGCACCCGGAGCTATCACCGACGGTCGATCTCAGTAAAGAGCCGTCG
ATCTGAGTATGAAGGGTTTAGGTTATTGTAGTGGAGACCGCAGAAAAGAATGAAAACAGGGCGATCGATACACGAGTGCATTCCTCCAGTGCTTCCCAAA
CTCGGTCACGCTCTATCTGTAACTGTACCTTGGTTTGCCTCCTAACTGCATACGTCCCGTGCCACTTGTCGaactgctgctacttctCTAGTCGACGTGA
AGACGTTCCTCAAGGTACTTGACGGCGTCCTTCGTGATGATCAGCAGGTCCTTCTGCAGGATCGAGTAGACGTTGATCTTGGTCTGCGGGAGCGTGTCCA
CGTACGGGATGTTGCGCGTCGCCAGCACGAAGCTTGAATCCACCTCCTCGCCGCCCACGAACAGCGCGTGGTCCCAGCCACGGCcacccagcagcttctt
catatCCTTCGTCTTGGTAACCTGCTCGCAAGTAACACcaaaaacaaacaaacagTTCACCATGTCAACACAAACCACACCATCACCactcagcaacaac
aacaacgtaCGTCGACGTCCAGCGAGTCCACGACGGCGAGCTTTCCCTCACGGAGCTTGGTGGACAGTGCCACGCGCAGGCCCATGGCGCGCACCTTCTT
GGGCAGGCTGTACGAGAAGTCGCGCAGCACGGGACCGTGCACGCGGTAGCCTCCGCGCCACTGCGGCGCGCGGATGTCGCCCACACGGGCGCGACCCGAT
CCTTTCTGCTTCCACGGCTTGCGCGTGGAGCCACTCACCTCGGAGcgcgtcttggtcttgttgGTGCCGGCGCGACGGCACGCTAGCTGCCAGCgcacca
cgcgctgcaggatGTCCACGCGGTCGGGGGCTCCGAACACCTCGCCGTCCATGGTGACAGAGCCCAGGTTCTGCGCGTCTTCgcccagcgacagcagctg
cagctccaggtcgCCCGTCGGCGTCACCTTGACCTCCTGCGCCGCCGAGATTACGCGCGGTGGAGGCATCGGCTTCTCCTCGGCCAGCGACAGGTTGGTC
GGCGCGGCGGCCGTCTGCGTACTGGCTGCGCGCACCAGATTAGCGCGCGGAGCCGACACGGTCAGCGCCGCCACGCCGCGCAGCAGTCGGTTCATCCCCA
CGGTCGCCATCGCTACAGCTCCCCTTTTGTGATGCTCTCGATGGATGGCGTTGTGTGGTCAATTCAAACACCCAAATCGGGCTTTTCAACATGCTTAAAC
AACACAACGGATTTTGAAATAAAACACAAGATGCTTTTTTTCTGTTTCATATACATATGGTATACAAAATTATACACATACTTTCTCCAAGTGGTTATTT
TCGGATACGGGGCTGCTGTGGGTGACATTGAAACGAGGTAGAAGTCACTAAAAACGTGAGCGCTCATCGGCAAAAAGTCAGACGCACTTGCGGCATCTTT
CCCCTTGCTGAAGCGAGCGCTGCCTCGATCCCAGCATGGCGACGCAACGGAGAAGCACCGCTCCGCGTGGGGACGGCAGCTTGACTGCCATCTGCACGCT
CATCGAGCGCAGCAACCTGGACCGCAAGTCCAAACTCGACAGCACCGGTCGCATCTGTTACGTACGACGAGAACTATGTACCCCTCTCTCCTGCCTCCCC
TACTAATAGCCCCTCTCTACTGTGaacaggagctgaagaacgatccgttgctgctggacagctTCCCTATGGAGCGGCTCATGAAGGCCATGCGTCGTCT
GGTGTGCGACTCGGACACGTCCACGCGCGCGGGGGCGCTGCGGGCCCTGCGCTacgccatcagcagcagcgacagtaTCAGGCACTTCGTGGACCTCAAC
TTGCCGGTGTTCGTGGTGCGCtcgctggagcgcgagcagaAGCACTTGGCGGAGCGGGTGCAAGCGCTGAAGGTGGTGCGGAGGGTCATGGAGATCGATG
CCGCTCAGATGCCGACAGGTCTCGTGGCGTCGTTGACGGCCGTCGCTGGACACAAGGACGACAATATGCGACGAGTGTGTttggagacgctgcgagAGCT
GGCACTACTCAACGTGGAGGTCGTGGCGGAGGCCAACGGCACGAAGATCCTGGTGGACGCCATTCTGGAGCCGTCATTCCAAGATCTGGCCGACTCGCTG
ctcatgacgctgctgctgattctgAACGAGCCATCCACGCGTAAGTTTATTGAGCCATTCGTGGACTCACAGGTGCTGTTGGCACCGTTTACAGATACCG
ATCTGCCAGCAGGGAACGAGCGGAGACAGCGATGGATGGCCAGTCGTAACGCCATCGTGACTATGATGCGGTCATGGACTGGAATGGTGGTGCTTACGAG
CAACCCACAGGGTCTGCAGTCTCTCATTCAACTGCTAGTGCGACCGGTGGGCGAGGACGTACAGAAAGCAGTCTTGTCCACTATCTGCGAGATCTTTTAC
AAGAAGACGGGCTTCGACAAGTCGGCAgccgatgcagcagcagacacacCAGCTCTCCCTGTGAGTCTGTCGAGCGCAGAGCAATTGCCACTTGCAGTCA
ACCACAATCTGCTGGACAACTACACAGTAATCATCCTGCTGGCCATGATTCACTGTGGCATTTTGGAGGCACTGGTGACTCTAGGCACGGGTCCGTCTCG
AGCATTGGCCGAGCCAGCAATGGACCTGCTGGCTGATATTTTGCGTATGGCCTCACGCTTGCTACCAGACCAGCACTGTGCGTCGTTACTTGCACTTCCG
CGGCTAGTATCGTCCACCTCGCTCACGACTACGACAACGATGTCTCTCGGAGATCATGCTAAGAGTCTTTCGGAGCGCCTACAACGTGAAAAGTCGATTC
GAGCTAGTGAGATGCTGGGTGAGCTGGCTAATGCTGTCGGCGCCAATTCGGGCAGCATTGCCACGCGGGGTGTGTCGTTAGTTTCGTATGGTGGCAGCGG
TGTTAATGGTGTGCAGCTGGCATCCGAGCTCCTGCGCGACACGAATCGACCGTCAAATCTACTGGCCCTGCAACAGATTGCAGGCGTAGTGCGTCTTCCA
TCATctagtggtggtggtggtattgGTGGAACTGGCGGTGGCTCTGCTAACTACGCTGTGGCGGCTCCTTCAACACAGCGTGGCACGAAAAGTGCGACGG
CGCAACTAAAGGATAGCTTAACTTCGCGAGAGTTGATGGTTCTCGAGCTGAAGCAATCGCTGGATGCACAGATGGACGACAGTACCTTTAAGGATATGCT
GCACAACCGCGCACGCGTACTGACGGACAAGAACTACAAAAACTGGAACTGGGATATCATCTCCGAGATGCTCGAGGGTCCACTAACAAACCCGCAGCGG
CTCTCAGAAGCTATGAAAACCAAATTTTTCAAGCGTCTGTCAGGTTTCTTCCGTTGCGATCAAGGCAACAAGGGTTATTTCTCCAACCTGTATTGGATCC
CAGACCACGTGCCTTATCTGCGTCCGGCCTGCCAAATGTATACGCTACTGTTGAATCACCCTGAAGgtttgctcttcttgaaGACTGACCGTCGTGGTCA
ACTGCTTACAGAGATTTCGTCAGCACTAGAGCTGGAGGCTCGACCTGAAGCTGCTATCGTGGAGTCGCACATTGGTGTGCTTAAGGCGCGCATGTTTTCA
CCTGACTATGTATCGCGGCGTATGCTGCGCGAGTATTTCACACTTCTGGGACTGATGAGTTCGAGCAAAGAAGGCCTCAAGATGATGGAGCAGTCAAACC
TGTTCCAGCGGCTCTATGTCATGGGGACTACTAAGGGGCATGACTTCCTGTGTCGTCTCATTCTAGCCAACCTGGACTACTCTGTTGACGGCAGCTCccg
caagctgctccagtctTGGATGATGGAGGGTTCTAAGGCACTGCGTCTGTATGCGACCTGTTTGTTGCGCGCGTTGCTGCGTTCGGAGGTGGCGGATTTT
GATAAGTGGGGTATCGATGCGTTGGTGACACAACTCACACAGGAAGCAGAGGTCGCCAAGGCTGCCCTGAGTgtactggaagaagctgccgagaCGCCTG
CATGCCTTCTAGCGATGATTCTGAAGCGACCGATGAAGCTTATTCAGCTAAAGGACAAGCGAGCCGAGTCTTTGCTTCTCAAGTCACTCTCGCTTGCTGA
AGGACTAAATTTTCTCCGCGACACAGGTGACTGGATTCCGCGCACTCTTGCCGCCTGGCGCCGTGAGAAACATATTTCATACGTGCATGCCGTGGAGCAC
GCGCTTTTCCGTGGCTTACATCGTGATGCCGCTGGACGTGAACGTGGATCAAATAGTAACTCGACCAACACGCGTCAAACGTGCTCCCCCACTCCCATCC
CGGTGAATGTGCCTATGAAGCGGGGCGGCGGCGTTGGACTCAAACCGCCGAGTGGTGGAAGCAGTCAACGATCTCTATGGGGGCTAGATTGGCTGTATCG
TATGCCGTGGAACATGGAGGTAAAGATTGTGGGCCCCCCAGGAAGTGGTCCTCCGTCGAGCCTCATTTTGGAAACGTATATTGATGGTGCGATGCGCGAC
GAGGATGAGACTACCGGCATCGACGATGAACTTCGCATGAACTCGATCCGTGTCAAGGGAATCGTTGTAGACGCGCGCAATATGCCACAACCTGTTGTCG
TGAACTCACAGCAAACATTGCAAGCTTGCTTGTTCCTGGGCACACAACCAGTAGATCGGCGCGGATTTACGAAGCCTCCTCCGCAGAGTAATGGAGGTTT
CGTGTCCACGAGTGGATCGGCCAGCGGCGGTGGGGCTGCTCTTTCAAGCGATACACAGCAGAAAATGTTGCGCGCGCGGTCGGCGTCGAACTCGGCTGGA
GGAAGCATGGACCGCACCTCGGAGACAATgatgtcttcgtcgctggacttTGCCGATACTGGATCGTCTTCGGTTGACGCAGCAAAGGAAGAGAACAAGG
ATTGGAGCTCGTGCCAACCAGAGCAGCGCTCACCCCAATACTTGTCGGCGCCAGAGTGTTCACTGTGTGCCCCTGGTGAACGTGCTGTGTGGAACTTCCG
TGTAGAAATGGACTCTGCTGCGGGTACCAACACTTCAAATGGCAGCGTAAAACGTCTTCTGCTCAAGTCTGTCGAATTTACGCTGCAATTGCTCCCTCTT
CGTCCGCGTACAGTGCCACTACCGGTACACTTGTACGGTGAGTTGGCAAAAACCAGTGCCGGCTGCCAAATCCTGCACGCATCTGGGCATTTACCGGAAT
TCCTCGCATGCCTGCGAGATGCTGCGAGCGTTCCGCTTGAAAAGCGTGCTGCACTGTGGGCGCTTGGTCACGTGTCTGCCACTCCACGCGGTTATGATCT
GCTGAGCCACTACGCACAAGACTTTGTGGAGATGATCGTGAAGCTGGCAACCGATTCGCCGCTCGTATCCATTCGCGGAACatgcttcttcgtgctgggc
TTGCTTGCGCGGTCACCTGCAGGCCGGCGGCACCTGGCGCGTCTTGGATGGGATGCCCCGCGTGATGCGTCTCGTACATCCATTGCTGTCCCGCAAAACT
GCACTTCTCTCTTTTTGTGGCCACCATCTGGATCGTCGAATCCCTGCCCATTGACACAGACGCCTGGCGCGTCACCCTTGCAGCGACTGCTAGTGCGCAG
GCGTGACAAAATGCCCAAGGAGTGGAATGAAGTACTGCGCTTTGTTGCAGATCTGAGTAACCACATCACCCAGAAGGAGGCACATGCTTCTCTCAACAAG
CTGCGTTCATCGAGGTCCGAGTTGTTCGAAGAGCCGGTGCTGTTGATGTACGTGCATGCGCTATTGGAGAAGTACAGCTACCGTTTGGCTCTACGCCAGT
TTGTGCTCAACGCGTTTGACCGAGCGACGCTGACTGATGAAGTGCTTGATACGCTACGgattgaggaggaggaggagcagggcAACCAGACGCGTCAGCG
TGTACCAACCGGACGAGAGCTGCGGCGGCGTCGCTCGTCACCTTCGATCCCTTCATTTACGGCCTCGGTCCAGTCACTGAACGCCGCCATGCAGGCTACG
TCTGGAGTCTCGCGCATGTCGTCCATGCAGAACGTTCTAAGCACTGGTGGCAACATGGGCGACCAGCGTTCAACGATGCGGCTGAACGCGCACAACGACC
CCATCGATCGCACTGTACTGCTCAAGCGCAGCCGCAAGCGCTCTGCTTTCTCCGAGAAGACCATCGTTGTCGGTGCTCCTGAAGCTGTTGTGTAGGTACG
TAGGTCTTTGAGGCTTGCGTAactaactacatgtagacgagCTTGCCATTTCAATACGTAGCCAAGTCTGTCATCATTGATCTCTATCGTGTAGTCCATC
TACAAAAACCTCCCAGAAGCCATGTCCATGAGCGAGTCGCCCAtgtgcagcacctccagcttgCACAACTTCACGTTGAGACTTGTGCACATGGTGATGG
CACCCCACAGAGTCTCCAGTCCGCCACGCTGGACGCGCAGCAGTGCCGTGCTGGGTTCGTTACTGTTTGCAGCCATTTTCTCGAAGGACAAGACGTCGAA
CTCACttgccgacgccaccacgacACCGAATGCTGTCTTGAGCGTGTTGTCAATAGCGAATttcagctgcttcacgtcGGCTACAGGCACGGACCCGTCC
TCGGAGAACCTGGCAGTATTAAAGCAGAACAATTAGGCACGACTGCCAGGATGTATTAAGCATTATGTAGCTGCCAACAAGGCATACATGGCGATCTTGA
GGTAACTGTGTTCACTATGCAGCGAGAACTTGTGGTGAGGTGTCGCC