Description :
From Genome Similarity Track
Location :
Scaffold_251:10996- 13704
Transcript NameFunction/comments
Hyaar_Emoy2813182Ptype ATPase (PATPase) Superfamily putative

Sequence
2708 bases(100 bases per row)
ACTTGGCAAGATATTGAGGTTGGTGATGTTTTGGTAATAAAAGACGGCGACCAGGTCCCTGCAGACTGTGTCCTGTTGGCCACGAGTCGGCCTGATGGCC
GATGCTACGTGGAAACGGCCAACTTGGATGGCGAAACCAACCTGAAGATTCGCCAGGTGGCTAGCTGCACAAAGCACTTTTGTAGTGTTGAAGAGGTTTT
GGAGCATCACAAACTTGAGGTGGAATGTGATATGCCCAACAAGGATTTGTTTTACTTTGACGGTGTGCTGAAGCTCGAAAAAATCGCGCGCGAGACTGCC
GCGGACTTAAAGGAGGACTTAGAAACCAGTTTGACGATGGGTAACTTGATTCTACGTGGTAGTGAAAGCCGCAACGCTGAGTGGACGCTTGGACTTGTGA
TTTACACGGGCAAAGAGACGAAGGTCCAGATGAACTCGGTTGCTGTGCCCCTAAAGCGTAGTTTCGTGGAGAAGACCTTGGACACAATGTTTGTGCTGGT
TCTGATGCTACTTTTCGGAATATCGATTGCGTGTACGCTAGGGAATAATAACTGGAATCTGGACCTGGCCGACGATTTGACACCGTGGTACATCCAGGAG
GAAACAAATGGCTACATCTTTTTGAGCTACGTGATCTTGTTTAACAATTTGATTCCGCTGTCCATGTACGTGACGATGGAAGGTGTGCGTTTTGTTCACG
CACGGTACATCGAAAATGACGTGGAGATGTACGACACCAAGACCGATACACCAGCTCAGGTTCGCAACAGCAATATTAACGAAGACCTTGGACAGATCCA
GTATATTTTCTCCGACAAAACGGGTACGCTTACTTGCAACGAAATGATTTTCGCGAAGTGTACCATTGCTGGACTGCGCTACAATGACGCTGAGTTTGAC
CCTACAAAACAAGCAAGACCTGGCACTAAGTTTGACGACGGCCGATTGCTGGCGCGTTTGGGGTCGAACCATTCTACTAAGCAGGAAATCCACGATTTCC
TTTTATTGCTCACAATATGCAACACGGTGATTCCAGAGTCGAATATTCTAACGTCACCTACGTCCGACGGCGATTCGTGCTCGGCCCAGGCTTCAATAAT
AAAATACAACGCGTCTTCTCCAGATGAAGAGGCGCTTGTGCTGGCTGCTGCAGACCTCGGTTACGTACTTACTTCGCGTGACGGTCCAATGTGCCATGCT
GTCATTCGGGGCACACCGATGTCTTTTGAAATTTTGAATGTACTGGAGTTCAACAGCGATCGAAAACGCATGTCGGTGATTGTACGGTTTCCTGATGGAA
GTATCGTGCTTTACTGCAAGGGTGCTGATGACGTAATACTCGATCTGCTGTCGAAGTCGCAGCCACAAGGCGTTGCGCACGTGACACGTGGTCATCTGCA
AGAGTATGCATCGGAAGGTCTTCGGACGCTGACGACCGCTGTGCGGCGCCTTACGCAAGAGGAATACGAACACTGGAATCAGCTATACCGCCAAGCAGAA
TTCTCGATGGAGGGACGTGCTGGTAAGATTGCCAAGGCCTCTGCTATCATTGAGGTTGAGCTGACGTTGCTCGGTGCGACGGCTATCGAAGATCGACTGC
AGGACGGCGTGGAGGAGTCGATCTGTGCACTGCGCAAAGCGGGCATTAAGTTTTGGGTGCTCACGGGCGACAAAAAGGAAACTGCGCTGAGTATTGGCAT
GTCATCCCATGTGATTGACGATAACATGGACGTTATCGTACTAGGCCAGCGTGATAAGGGGTCTTTACGCGCGAGGTTGGAGGAGTTGTACGTAGATCTT
GTTGAGGACAAGTGGGGTTCAGACGAGACTTCGTCGGCCGTTAGTGTGCTTTGGGAAGCCTTAAAGCGAGCAATTTTTTACTTGTGGGATCTTGTGAAGC
TGGCTCTACTAGGACGAGACGAAGAAGGAGAGGCCCGAAAGAAGCGGAGACGGCTACCGCGCCGGGACCAATCTGGTGCAAACGCGGCACCGGTCGGTAG
TCCTTTCCAACATGAAGATGTGTACCCGGCACTTCCGAAGCGCGACGTGTCTGAAAACAGCTTCGACCGAGATTTGTGCGACCATGACTTTGAGCCAAAA
ACAGACGCAGTTACCGGCGACACTGGCAGCATGAGTAGCAGTGACTATGCGGATGAGGAGCTGGAATTTGCAATGGTGATTGACGGCAAAACGCTCGCGC
TGGTGCTAGATGATGACATCAAGTACCTTTTCTTGGCAGTAGCAACGCAATGCAAATCGGTGATATGCTGTCGCTGCTCACCCGCTCAAAAAGCATCGGT
CGTAAAGCTTGTAACGGAGCCTACTCTCATGTTCTCTCCAGGCAATATTACGCTCGCTATCGGCGATGGTGCCAACGATGTACCGATGATTCAGGCCGCG
AATGTGGGTGTTGGTATCAGTGGGAAAGAGGGTCGCCAAGCTGTGCTTTCCAGTGATTACTCCATCGCCGAGTTCCGGTATTTGAAACGCCTCCTTTTGG
TTCACGGCAACTACAGCTACAAGCGGATTTCCAAGCTCATTTTGTTCTCGTTCATGAAGAACGTAGCACTGTCTTTGTCCAACTTCTTCTTGGCGATGGA
GACAATGTACAGTGGGTTGCTGATGTATTTCAGCATCTTTTTTACGCTGTACAATGCGCTCTTTACGACGATTCCAATCGTGGTTATCGCCATGTATAAC
CAGGACGT