Description :
From Genome Similarity Track
Location :
Scaffold_228:10996- 13390
Transcript NameFunction/comments
Phyke_g6913hypothetical protein PHYSODRAFT_342406
Phyke_g6914hypothetical protein PHYSODRAFT_356206

Sequence
2394 bases(100 bases per row)
GAAAGCACTGCTCTTTGTGGACGAGTTCCCGTGGGATCTAAAGACGCAACTGCGTGTAACGCTACTGGATCACAATGCGCTGAGTAATAAACGCGTCCCA
CAGATTGAAAaactgcaggtggtggagatcgtgGACCATCACTCggacttgcagcagcatctggaTGCTGAGACTCGCGAAGTGGCCTTTGCGGACGGCA
GCGCACTTGTGGCGTCCACTTGCACTCTAGTTGCAGAGAGATTGGCGCTGGCGCCAACGGATAGTACGCACGCACTGCTATCTACGATGCTACTGGGTGT
CATTGCGCTGGATAGTATTAACTTCGACCCAAGTGCTAAGAAAGTGACGCCTCGGGAtgtggcagctgcagtgcGTCTGGAAGAGACTGcgttcgccaag
aaggaggagctgttCACGTGGTTACAAGGAGAGAAGTTCAACCCGGTACATTGGGGAGCATTCACGCTGGAAAACTGTCTACAAGTGGATTACAAAGAGT
TTGTGTTCGCTACAGCTGCCGGCGATGCCAAGAAGGTCGGCACCAGTGCGGTGCTAATTGATCTGGAAGCATTCGTGCTCAAGTCaagcgatgctgctgc
actgcATGAGGGACTCAGTGCATATTGTCAACAGAACGATTTGACGTTCCTGATGGTAATGACGATGTTCATGACCCCCGACAATCAGCGTCACCGCcag
ctgctcttcttccaggaaACCGGTGACGATGCTAAGCACTGCGTgtcgttcttgaagcagGAGGGATCATTGCAGATGGAAGCGTTGCAACTGCCCCAGA
CGCACCAAGAGCCTCACATAGCCGCCTTCAACCAACTGAACACTGGTGTGTCCAGGAAGCAGGTCGTTCCGTTGATCCAGCAAGCACTCGCTGCCGAGCA
GTGAAGTTGTAGTGTCGATAGGAATCTGCCGCAGGTTTACTACAACGTGGCGAGTGTGCTACCACACTGCTGAACTCATCGGTGACGTTGCAGACCTGCC
ATGTAGTAAAATTACCAACAGCATTATGGCGGCAGTAAGGTGAAACATGCGAAGCTGAAGGAAGTGATGCAATCGAGTTGATTGCATGCAGACGGAATCG
AAGCAGAAGCATTTTCTCGTGGCAATGTAGCCAGCCCATTTGACATGTAGACGAATTCCGAGAAAATAAAGTAACTGACGTCTGTGACATCTTCTGATTG
GCTTATATTCCTTCACTACCGAAACGGACGGTTAGTTTACCGAGAAGCTGGCTATAAAAAACCAGTCCCAGTTGAGAATTCGCCCACCAGCCAGCCAGCA
GTCAGTCAGCACAAGAGCTCCAGTCGCTCCTCGTCTAGTGTCTGCCCCCTACGAGTTTCCTCCTTCTGACCCACGCCCGACGCAAGCAAAACATCCTCGA
CGTCTTATCCCGTCGAATTGATTCTGCTGTCTCCCCGTCGCCTTTTTCCTGGTCTTTTCGCGACCTCCGGCTGACTTAATTGAGCGACCCTGAGTTCCCT
GACGCTTCGACGAGTCCACTGGTTGTGGGAGTGGAGAGCAGCCCCGCGCCGAGCTTTCCGAGTGTAAAAGAAGCGTTTCCCCCTCCCGTTAAGTACAACA
CTGACGGTGACCTCGTGCGAGTAAAGCTGCGCAGTCGACGGATGGGATAAGTTTGTTGGGCGAAGCACGAAAGACGCCGACCCCCTCGCGACCAGAAGCC
TCCTTGACCCCctaagagagagagagagagacaTTTGTAGAGCAGTTATTTTTTTACCTTATTGTGATAGAGAGACACGATGATCGCGCCAACCAACAAG
CCGACGATGGTTAAGTGGGAGCATCTGTCCTTCGTGATCATGGACGCCCccaacgacagcaacttgcACATTTAcctcaaggagctcaagaaacacAACG
TCACGGATCTCGTGCGAGCGTGTGAGGTCACGTACAGCAGCGAGTCCGTGGAAGCTGCGGGCATTCATATCCACGAACTCGAGTTCCCTGATGGAGAGTC
CCCTGACCCAGAGATACTGGACCAGTGGCTGGATCTGGTCGAGGACTGTTTCAAGGATAATACCGCCGACTCCAAGAACAACAAGTCCATTGCGGTGCAC
TGCGTCGCTGGGCTCGGCCGGTGAGTTTCCAGTTGGTGAACCTGCTGCTATTGACGACGTGCTAACTCAATTGTTATTTGACGATGGACAGAGCTCCTGT
GCTGGTAGCCATTGCGCTGATCGAGTACGGACTGGACCCCATCAATGCAGTGGAGCACATCCGCAAGTTCCGGCGTGGTGCCATCAACCTGCGGCAGCTC
AAATACCTGGAGAAGTACCAGCCGCGACGTGGCAACAAGGCTAAGTGCACCATCATGTGAAGGGGCGGTGAGGGGAGAGGATGCCAGACAGGCG