Description :
From Genome Similarity Track
Location :
Scaffold_26:109952- 111036
Transcript NameFunction/comments
Phyci_5499Hypothetical protein

Sequence
1084 bases(100 bases per row)
CACCATCCGCCATGAAGTTTTTCGCGCCCCTCGTCGCTGCCTGCTGCTCACTTGTCGTGTCCATCACTCTCGCTGGCCCGGAAGAGACGAAGTCTCGATC
AACTCTACGCTGACGCCATCGCCGAAGGAGGCAACCTCATCATGTACCACGGCGGAGACTTCGCGTTGCAGCAGGACACGATGCGCCAAGCCTTCGTCAA
GCGTTTCCCCGACGTCAACTTCACGCTCAtcattgactacagcaagtaccatgacgtgcgcatcgacaactagctggagaccgacacgttggtgcccgac
ctcgtggcgctccaaacactgcaggacttccctcgctgggcacaacagggcaagctgctcgagtacaagcccgccaacttctcgcaggtctacgacggct
tccgcgaccagcgtggcgcctacatggcctacatggcgatcaccttcagctacctgtacgacgacacttcgctaggcggactcccggcgccaatgtcagt
ggccgacctcgttgacccgcgatgggcgggcaagatcgcatccacgtacccacacgacgacgatgccgcgctgttcatgtaagtgcgctacgtcgagaag
tacggctgggactgggtcaagaacctggccaaccaggacgtcgtgttccgccgtggttcccacatcaccaccgacgcggtgacggccaagggtaaggtcg
tcggtatcggcacGTACTCGCAGGGCACGCCCAACGTGACGTTTGTAGCGGACGGTGATAACGACTATCTGTCGTGGGGCCAGCGTATCGCCATCCTCAA
GAAGGCCAAGCACCCGGCGGCGGCCAAGCTCTTCACGAACTGGGCCATTTCGGAGGAGGTGAAGAAGACGGTTGTCGCTGAGAACGTTCGCGTGGACCTG
GCGCCCAACAGCGGCTCGAACCACCCGTGGGAAATCCCCACTGCCAACGTGGACGAGTTCCCGAAGTTCATGGCGGACCGCGAGGCGGTGGAGGCGTGGA
AGCAGACATTCTCGCTGTACTTCGGCGAGGTCCAGGTCGAGGCGACGCCGGGCTACCTTGGTGTGCACCCTGGGCTGTAGGTTG