Description :
From Genome Similarity Track
Location :
contig_111:109916- 114197
Transcript NameFunction/comments
g11212.t1hypothetical protein

Sequence
4281 bases(100 bases per row)
GACGGAGGGCAAGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAG
GTGACGGAAGTGACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGA
CCGAGGAGGTGCCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGAC
GGAGGGCAAGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTG
ACGGAAGTGACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCG
AGGAGGTGCCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGA
GGGCAAGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACG
GAAGTGACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGG
AGGTGCCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGG
CAAGAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAA
GTGACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGG
TGCCGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAA
GAAGCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTG
ACCACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGC
CGTCCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAA
GCCCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACC
ACCGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGT
CCACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCC
CAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACC
GAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCCA
CGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCCCAA
GTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACCGAG
ACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCCACGA
GCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGGGCAAGAAGCCCAAGTCGA
AGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACCGAGACGGT
CGAGACGACCGACGTCAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAGTGACCACCGACTGAGACGACCGAGGGAGGTGCCGTCCACGAGCGAG
GTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAGTCGAAGA
AGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACCGAGACGGTCGA
GACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCCACGAGCGAGGTG
ACGGTCGAGACGTGGACGACCGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCCC
AAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACCG
AGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCCAC
GAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAG
TCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACCGAGA
CGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCCACGAG
CGAGAGTGACGGTGACGACGAGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGC
CCAAGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCAC
CGAGACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCC
ACGAGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCCCA
AGTCGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGACGGAAGTGACCACCGA
GACGGTCGAGACGACCGACGTCAAGCCGGAGGAGACGACGGAAGTGACGGAGGTGACGGAAGTGACCACCACTGAGACGACCGAGGAGGTGCCGTCCACG
AGCGAGGTGACGGTCGAGACGACTGAGACGACCGAGACGACCGAGATCGTGGAGGAGACTGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAGT
CGAAGAAGCACCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGACGAGACCACGGAGGAGACCACGGAGGTGA