Description :
From Genome Similarity Track
Location :
Scaffold_104:10990- 12816
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_21329Hypothetical protein

Sequence
1826 bases(100 bases per row)
CGCTGCAACCCCGATGCATTCACGTCGTCGCTCGACGAGCAGCTCAAGAGCTTTGCGAGCGAAGGCCTCCGAACGCTCGTGCTTTCGCAGCGCGAACTCT
CGAAAGACGAGTACGAACGCTGGAACAAGACGTACCAAGAAGCTGCAACCTCGCTTGTGAACCGTGACCAAATGCTCGACGACGCGGCGGAAGTGCTCGA
GGTCAACATGGATGTGGTCGGCGCGACTGCGATCGAAGACAAGCTCCAAGTCGGTGTCCCAGCGACCATTCACAACTTGGCCATGGCCGGCATCAAGATT
TGGGTGCTTACTGGCGACAAGGAAGAAACCGCCGTCAACATTGGCCACGCGTGCCGGCTGCTCAACCAAGACATGCAGCTGCTCTTTGTGAACCGCGAAA
GCCTTGACGGGCTCATCGAACAGGTATCATCTAGTGGATGCTGCCATGTTGTGGTCGGTTAGATGCTTCATGGAAATTGTTTGCTAGATTGACTATCTGT
ATGGCATGGAAAGCGTCCAGTCGTGCTTCAAGAAGGGCATTGTCTCGGACCGATTGGCGGTCGTGTGCGACGGCAAGTCGCTCGTGCACCTCTTTCCACC
AAAGAAAACATCCGCGGCCGACCAAGCCACCGCGAAGGAGCTTCGGCGCAAACTTCTGGTCGTCGCGAGCGTCTGCAAAGCGCTCATTGCGTGCCGCGTC
TCGCCGGCGCAGAAGGCCGACATTGTCAACCTCGTACATACATATTGCTTTCCATCGCAGCCGTCGACCAACTGCAACTTGTAGGTCCGCTTCAACTCGG
TCAACAAGCCGATTACGCTCGCGATCGGCGATGGCGCCAACGACGTCAACATGATCCAGTCGGCGCACGTGGGCATCGGCATCTGCGGCCAAGAAGGCGT
TCAGGCCGTGAACGCGAGCGACTATGCGATTGCACAGTTTTGGATTTTGATTTCTAGATTTTCCATATTTGCCCAACGATTTAATTTGCACAAGGATTCT
AACGTTTGGACTAGATTTCTGGAGCGTCTTTTGCTCGTGCATGGCCGCAGCAACTACAAGCGCATCGCCAAGGTCATCTTGTACTCGTTCTACAAGAACA
TGTCGCTCGTGATCGTGCTCTTTTTCTTCAACTTTTTCAACGGCGAGAGCGGCACGTCCCTCTTTGAGAGCTTTGTCATGGCCGGCTGGAACTTCTTTCT
CGCGCTCCCGATCATCTCAATTGGCGTCTTCGACCAAGACGTGCCGCCAGCGCAGGCAACGTCGTACCCACCACTGTACATGACCGGTCAGCGCAACGAA
GACCTCAACGTCAAATGCTTTTGTATCTGGATCGCCAACGCCATGTTTCACGCGTGCGTGAGCTTTTGGATCCCGCTCTACATTGTGCCTGCGTATTCGA
CGCACTCGTTTTACCTCCAAGGCACGACGATCTACTCGGGCTTGCTCATGACCATGAACGCCAAAGTCATGCTGGAAACCATGACCTGGACGCGGTTCAG
CTACGCGGTCGTCTCGTTCAGCATCCTCCTCTTCTTCTTCTTCCTCCTCGTGTACCCGTACATGACGTTCCTTGGCACCGACATGATTGGCATCACGCCT
GTCATGCTTGGCTCGTACGTTGTGTTGATTGCATGCTGTTACTGAGTGTGCGCACATAGGACTCTCTACTGGGACGTCTTCTTCCTCATTCCGGTCGCAT
GCATGCTCGTGGACGTCAGCGTGAAATAGTAGGTCCCGCCAATGTCTTTTGGAGGATTTATCGCGGTTTTATGATAGTATTCGGCGGTTCTACTACCCCA
CACACGCCGATATTTTGCGGGAGCGC