Description :
From Genome Similarity Track
Location :
Scaffold_2347:1099- 2969
Sequence
1870 bases(100 bases per row)
GTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGGCAAGACTCCCAGGATCTCATCTTCCCC
TTTCGAGCATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAGCAGCCAGGCTAGC
GTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACGCGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTC
CGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTC
GCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGATCCACGAATGCGTGTTGA
GCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCT
GTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGT
GGTCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAG
AAGGATTGCATCGCCCGTAACGACTGCGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGC
CTAAGTAATCCACCTTGCGCATTCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCATCCAGTAGGGATGTCACTCTTTCGCA
CAACTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCTCA
AATGGATCTACTTCCGTATGATCTTCCCCGGATCCACCTCTTTTGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATTATACGTTGGTAGA
TCTGGGGTGCGTTCTTCAATCCAAACGACATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGT
AACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGACATCGGATACACCATC
AATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACG
TTGAGCAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGCGATCGG
TTTCGCGTCGCCGACATCGATGTATCATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTC
TGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCA
CCGCCATGCCTTCTCCCAGATCCTCTGCGTGTAGATCCCCGCCTTGATGGTAACAGACTTGCTCATCTTC