Description :
From Genome Similarity Track
Location :
Scaffold_27:109894- 111494
Transcript NameFunction/comments
Phyca_LT1534114882Hypothetical protein

Sequence
1600 bases(100 bases per row)
gaagatttctaatacaccttcgattcccacgctcggaatgcgaataacagcagtcaggaatggaacacttctggaatgtgagctgtggtgtagagggagt
cagaaatatccgattcacagggaaaggaattatcgacaagatttcagggcggtttccgcacagttgcttttatcgcatgcttgaatgagcccgacaacaa
attattaatttctacagtacaatctgttgtgagtgttgcttgaatgaaccctagacctggatgagtcacaacgaaaaccgtttatttatacttacaggat
atacattattataatcgaagagcatttttagttataatcaaagagcattgttagtgcaaattctacttgaacctgatccgattcaacgggggtttaatta
tgcgcgcattggtacgatataaataccgtatgtggtacacatcacgtgagaatgattcttagacggaattcgtcggacattcgtcggactactggattct
gtatgatatatcatagtttatgcaaattgtagggacaatctttgctaacatcactacgtctcgctacgccttttcttcgcttgtcgaaggagtttcccaa
tggtagaccagctgagctgccctcgacgccttatacgggattgcccggttgtggactcaacagcaacactatctacgcatgccaggtacacattaatggc
atcttcgatactttgacagtgcgtacacattaatggcaccttcgatactttgacagtgcagaagcagattctttgatgtagcatcgcaccaattccgttc
cccacgtctttagctagcttgtttttgagtctttgcagctctgactccagggttttagccattgtaaatccgaaatcgcggtagagattgaacaatgctg
ccctatgagtattgagtgctgagtagctgagagggctgccatctctgtgttttaaagtcatctgccaagtgacaaaatcttgtgcgtggagtttattgat
acgactgcctgcaatccgagtgcgtcgtggataggtnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntccttaacacacttgtagggatgacacctcgccaactcgcttgacgagagctcttggagtgact
tccatcctggtacgccactcgcgggaggacctaagtggacctctggagtgaggtagacagggtagttcactcaagtagccggtagacacatacttaggcc
agnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn