Description :
From Genome Similarity Track
Location :
scaffold_94:10988- 12895
Sequence
1907 bases(100 bases per row)
TCTTATGAAGACAAGCAAAAATTTAAGCAGCAGTAACAGGAGACGATGGCCTTATCAACTTGACATTGACGAGCTTCATGTTCTCAAAATCAAGAGTAGT
GATGACGCTCTTGATGGTCGTCCACACTGCTTGTGCTGGTTTGTAAAATCTGCAGACGTCTGACGCGACATTTATCTACCCACAGCGCAAACTGACTTTA
AAGCCCATCAGTACTTTTGCCAGATTTTAGTACTCAAGGTACGCCATCTTCCAGGTTGTTATAAGCTTTGCATAAGGGAAGCTACAAACAAATCGAGAGT
GGGCATTTTTCTAACTACATTGAAAATGAATAACAAAATCATTAAACGCCTCTCAGATGATAAACGCTTAAACtttgctctgctatttcagGAGTACCAA
AAAGTGTTACATGGATTAATTCGTTTCAAGAGCCATATACTCCATTATTCTAAACTAGAGAGAACAACTTATTTCAGCATCATGGTCTATCTGCAGAAGT
GCTTTAGAGAAATTCCCACAACACAATTCACATGTTCTGTCTGATCATCTGTAGTGTAAGGTCAGCGGTTGACACTGACGAGCATTTTAAGCAATCTTTC
GAAAAGTGTATCCAATATATAGATAACGGCAGCTTTGTGACAGATAGTAGCACTTTGGCTGTATCCTCACTGGTCACAAAACTGCAGACAGCAGCTAGGT
CAGCCAAACCACTCAGAATAACCCTAAACACCAGAATACTGGTCTTGCTAGGCGCGTCCTCCAAAAGACTACAGAAGCAGCTCACACTTATTTTCTACGA
ACACTCTGGAAGCGAAGACTGGCTAAAGGTGCTGCCGCAAGTGGAGAGCGTTTACTCCACTGTCCTGTCTAGCACGTGGTCAAGTATGTGCTTTCCCACG
AATGCATGCTAGGTCACTCATGCATAGCGGTCACCTGCTAGGTATTATTTCGTTATCTTGATGGACACTCGCAAGGGTATCATGTATATCTTATATGATG
CTGTACTCAAGGCCCTAATCATGAGAAGGCTCCATTACGCGCTGTGCCATGAAGGTCATTGCTGTGAGAAAAAACAAGCCTCTGGTAAGTCATAGCGGTA
CAGGCGTGCAAACACGCGCTTTTATAAAGCGACATCTAAAGTCTTAAAATCCTTGCATTTCAAGGCTTTTAGCAACACAACGCATGTCGCATCCGAAAGT
GGGTTGTGCGTATTACCTCACCAGATGATGTTGCCGTTATGACATGTGATAATTCATAGCTGAAGCGACAGGAAAGCACTTTGATCACCACATTGAGCTC
ATCCGGCAACCTCAAAGGTATATACGGCAAAAAGGATAATCATCTTTTCATTTCCTGTGGTGGCTGCAATGACGACGTCGCAACAACGCATAacatgtat
agatcacaaaccacTGAGACCAACTCACAAAAGGCACTCGGGACGTGACGAGGGCGTCTTTTATTGCAGGAAGCATCTTGCCACAAACAATGGAATGTTT
CTCGACAGTATTCAGCTGGCATGTTTGAACATTACTAGCGTTGGCATCACCTTGGAGTAAGGCTAGCCAATAGCTGAGGTTGAcgtatcacagacgacgt
agATGGTCGACCTAGATTAAAAAAATCGCACGTATGTAGCAATTTACAGCTTTATAGGGCGCCTCTAATACCGCACTTCAACACCGTTTGACACTTTTAA
GGGCTTAGTGAGAGGCCGTGTCATATCGGTACAGTTCGCACTGCATTTGAGCAAGTAGTTCGTCAGGCAAAGCTATTTTTTCAAGTCTTTTTAAGACAGA
GAAACGCGCTAATATACAACAGTCATTAATTTTTTCCTGCGGACGTTGTGATTCGATAAAGCAACCCAAACAGGATCAAAATAAAGCCAAGTACATTCTT
GAATTTA