Description :
From Genome Similarity Track
Location :
Scaffold_411:10987- 12366
Sequence
1379 bases(100 bases per row)
GCCAAGAGAGTGTAGCACACTTTCAGCAATTGCAATAGCGCGACTACTTCTTTCTCAGCGGGGTGATAGCCGAGTTCGTTCTCCTTTAGTACGCGTCCGC
AGAAGCGAACTGGGTGCAGCTTGTCGTCGTGTGGTTGCATCAACGTACTGCTCAGTGCCCAGTCATTGGCGTACAACATTATGTGGACTTCTTTCGCCGA
GTCGAAATGACGCAGAATTCGAGCTTCTGCTACCCGTCTTTTGAGCTCGGCGAATGACGCTTTTGCTGACGCCAAGTCACCCCCAGGACCAAAGTCCGTG
TCCTTTAGCTGATAGATTACCGCTCCATAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTAATTGCACCGAGAAAAGCTTGCATCCCTTTCTTTG
ATTTCGGGAAGGAGAGCTCGGCGATTGCGGCTATCTTCTTCGCATCAGCGCGTATGCCACTCGGCGTAATCTCGTGCGACAGGAAATCAACCTTGGGTTG
GACGAAGATACTCTTGGTAAAGCAGATGCCAATTCGACATTCTGTGAACCGGGCTAGTAATCGGGTCGAGTGTCTCCAAGCAGGCGTCAAACGTCTCCCC
TCCAAAACAGATATCATCGACAAACGACCTCCGCTTGAACACCGGAATCAAGGAAGACTGGTCTGGTTCTTCATTAGCGAACATGTCGCCCGTCCGGTCC
GTTGACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCCACTTCAAACTTCGTCAGCTGACCCTGCGTTGAATCGCTGACTTTGCCGAGC
TCGCCTCGCCGAGTTCCCGACTCGGCTTCAGCAATAGCCATTCGTTCAGCAAACAACTGCCATCCTCCCTTTGGTTGAACGTATCCCCATAGAGCATTGT
CGATCAGTCGTTGGTAAATCATGGGCGCATTCTTCAATCCAAACGGCATGCGTAACCATTCAAAGTGTCCAAGTGCACAGACGAACGCTGAGATCTGCCG
AGCTCGGCGTGTCATCAAGACTGCCCAGAATCCGCTCGCAGCATCAAGCGAGCAAAACCACAAGTAACTCTCCAATTCGGTAAGCAGGTCATCGACTAGT
GGCATAGCGTATTCTATCGGCGTCGTAATCGCATTAACTAGTTTATAGTCAATGCATAGCCGAATATCCACACCATTTTTCTTGAGCACTATCACCACTG
GCGAGGCCCAAGGGCTGCCCGAGAATGATATCAATCCAGCTCGAAAGCAGCCCCTTCAACAACTCGTACAGTTTGCTCAAGTGGCGGAGAGGTATCCGCC
GAGCTCTCTGCTTAATGGGTGCGTGTCCTTGAACCTCGATGTCGCACAATGCTCCGTACGCTGGAGGTGGCAGGGCATT