Description :
From Genome Similarity Track
Location :
Scaffold_109:109854- 110937
Transcript NameFunction/comments
Physo_142168hypothetical protein

Sequence
1083 bases(100 bases per row)
GCCTGCTGTGCAAACACGTCAAAGGACCGAGGCAAATTCAGCGCCAGTATGGACCAACCTTCACGGCAACTCGACGGAATGAGGCGCTGCATTGGGATTA
CCTCTCGCTCGGGGAGGGCTACGGTGACAACGCCTACCTGCTGGTGCTCAAGGACTCACTGACGCACTACTGCGAGCTGTACCCATGTGGCAGTGCTACT
GCCTATATTGCCGCAGAGTCACTGCTTGACTGGGTGAAGCGATTTGGCCATCCCGACATGCTGATCTCCGACCAAGGCACTCACTTCCGCAATGAAACGG
TTGACCACTTGTGAGTAGCGTCACGATTGCGTTTCGATAGCAGCCTTGTGTAGTAGCTGAGAGGTACATCAAAGGCGGAGACATACACTGGCCGTGGTAT
CGATCGGATCATCTCAGGCACCGACCGCACTGGGTAGAAGCTGCGGCGAAGCCGCTTGTTGAGCTGGCGAAAATCACACACCAGTCTGACCGTTCCATCC
TTCTTCGGGATGACGAAGGCTGGACCACTTGTGTGCCCGCCTGAAGATGGACCGCTCTTTCTCTCCGGTGTACACGCCTTGGGTGAATGGGACGATTGAG
CGACTGAACAAGGACGTGCTCCAAGTCTTGCGCGCACTGCTCCTTGACTATGGTCTGGATCGCCACGAGTGGCCGTACCTACTGCCTGTTGTCCAAGCGT
GCCTCAATCATGCGCAAGTTCGATCCCTTGCCGGACACTCGCCCACCGAGCTTTTCACTGGTCTCAAGCCAGCGTCGCCGCTGGATGTGATTGTGCGCCA
GACCCCTGCTGGGGAAGAGCTGGTCGTGGTTGACCCGGAAGATGTTTCGCGTCAGATCGAGAAGCTGCGTGCGTCGCTCGAAGGCATGCACAAGGAAGTC
GTGGACAAAAAGGAGCGCCGAAGGCTGTTCGACATGCAGCGCAAGAATGGGGCGGAATGCAACTTCGATATTGGCGACTTTGTGCTATGGTCGCGTATTG
ACCAGCGCCTACCCAATGACAAGCTCCTAGGCCAATGGCTGGGTCCCTTTCGCGTGGTGGAAACGACTCCTCACGCGTTTATT