Description :
From Genome Similarity Track
Location :
Scaffold_5:1098524- 1102231
Transcript NameFunction/comments
Physo_128809hypothetical protein
Physo_128810PREDICTED: similar to inositol polyphosphate 4-phosphatase type I alpha 3

Sequence
3707 bases(100 bases per row)
CCTTGGGTTCCCGTCGTCGCTTTTTACACTGGCCTGCAGTTCTCTCACGAATATTGTCAGCACGAGCTTCGTCAGAAGTATCGCGAGCAGATCAACGCGC
TGGAGGAGCAGCTCCACGAAGCCACCCACTTCAACCCGACAGTGGCCGCCCTCCAAGCGAAGGTCGAGGAGCTGGAGCAGAGCAACCGCGAGCACGAGCA
GAAGCTTCGCTTTGCGGTGCGTCACTTGGAAGTCCTGGCGTGGGAGACGAGTCACTCACTCACTCATCGGATATGACACAGGTCCAGAAGTTGCAGCGCA
GCCGGAAGCGAGAGAAGGAGCTCAAAATGATGAACGATCCATTGTGGGATTGACACCTCGACCCTACAGAGTACAACGAACTCAATTCACAGACGGCTAA
GAGCACGGCAAGCTTACCTACTAGACCTTTCAGCAAAGCCCCACGGCTTGTTTTAAGAAGCCACGTGGGAGTCCGCGCAGGCGAGAGGCGGCTTGTAGCA
GTCAGGAATGTACTTGAGCTGGAACGAGTTGAATGCGAACTTGGTTTTGCCGGTATTTGCCAACACGTTGACCCGCCGCACGCCGCGTTCCCTCATGGCG
TTGCAAAGGTGCACCCCCTGCCTCACGTGGAAGTGGTCCACCAGCAGCCGCGAAGTCTCCAGCGTCACGGACATCGCCGTGCGGTCCTTGCCGCTCTTGC
AGCACGTCGTGCGTCCTGCCCCTAGACGCCGACAGATATCACTGGACGTGATGAGGATATTCACGAACTTCTTCTGCACATTCTCCGTGCGAATGTTGAG
TCGGCCCGTCAGCGCTTCAATTTCTGACTGTAGCTCAGCCAGCTCCGCTAGATCTGCTCCCCGCTTCTTGTCATCAACTGCGCCAGCCATCACTTGGGTC
TGGTACACTCGGAAATACCGCTGCAACATCTGCACACTCTCGAAGTTGAGCTCATCCTGCAGACTGGAGTTCAGGTAGTGATTAGCCACTGACTGCATCT
CATTGATGCCCTGGGTGAACATAACTCCGTGCAGTTTAATCGCGTGGCCTTGCTGGAGCACTTCCGGCAGTTTCGCAAACACGTCAGGCGGGACAGCGAA
CGCAACCACGACGTGGTCGCCGGTTGGGGTGCTTGTGACACTAACGCACTTCGACATTTCCATGCGCGGGTTGGTCTCTCCAGACTGGACAAGCTGGAAG
CTGACAACACTGTTGAGCCACCGCACGCCCTCGGACATATCCTCAAGCATTCCCTTCTCGGCACCAACCGTGCTCAGCAACGACTCGATACTCAGCAAAA
AGCCCGTCGAGCAGGACAACTGCAGGCGCTGGCGGTGCAGACCACCGCGAGTTGCAGCCAGACCTACGGCATTCAGGAATGAAGCACCCGCAATAGCCAG
CACCTGCGAGCGCACAATGTCTTCTCTCATTTCAATGCGTTCGCGCAGACGAGGGTCCGGTGGGCTTTGAGACACCAACTGCTGCTGAAGGCGACGCAAG
CCACCCTCCTTGAACCCCATAATGTGAGCGGCAGCACAGCCGTGGGTCACCACTGAGTACACGTACTCGGATGCGGCGGACGTCTCGCTATCGCTATCAT
CAGATGTAGAGTCTTCGTCCAACGATGTGGAGGCTAAACTGCCTCGTCGAGCCTGCTCGCTTCTCTCAGCATCGTCTGCCAGATGCACCCGCCTTCCACG
CACTAGGTGACAGTTAAGATTGGTTGCCATGAAGGCTGTGGCCTTGTCCTTCTTCATATTGCTCCGTTTCAGGCATCCAGTGATGCCCTGCTCTCGTCCA
TCTTCAAGCGAGGCCAGCATCGTCTCATATCGCTTGAGGTTCTCTTGATAGGACGCATGGAGCCGCATGTAGTGAGCCATCTCAAGTTCCACGTCCCGCA
TCCGATCCTCCACATCTTGCACGCGAGCGCTGGAAGAAGCATTCGCGCCCGAGTTGGCCTGAATATGTTGCCGCATGTCATGGATCACCTGCTTCGCTTC
GTCGATGCGGGTGACGTTACGACGCTGGAGATACTTGAGAAAAGCGACAGTCATCGAGACTGACACGTACGATGCCGACAACTCCTCGGAAACCAGAATG
TGGTTGGGCGTGGACGAGTCCACCTGACCGCGAAGCATCTCACTGTAGCTTAAACCGCCCCTCAAGCTGATAGCAGAGCTAGCCAGGTCCCCTGACTTGC
GCTTCTCCATCTGCTGGGTGTCCACCAAGAAGTGGTGCTTCGCATACGTGTACGCGTGGCTCACGTTGATGCTGTGGCTGGGCGGGACAAATCGGTCCAG
GATGAGATAGTAAAGCTGTTGCTTGGCTGAGTCCTTCTGGTGACACTCCAGCAGCATGGACGATTCACGCGAAAACAACACGTCCAGCGCTGAAACCCGC
ACGAATCCAAGCGATTTCTGGTGCTCAAGAGACTCGGAGGAAGGATTTACCACAGAGTACACCTCAAACTGCAGCATCGAGCGCGCAGCACGAGGAACGG
ACAGCAAGGCGTTGAAGTCTCGAGCGTAGTAATCGCCGCCGCATGACCGGAGTGAAAGTGAGCTCCGCATCTCCGTCCGTGATATTTCCTCCGGTCGCTG
TCCCTGACCGATATTGAACAGAACCACTAGCATCTGCGGCACATCTTGCACCGCCTTGCAGCCCACCGACACAGCCAGCTCCACGCTCGGGCGAGGTTTG
AATCCGGGCAAACTCAAGCTTGGAGCGCGCGCAGAGTTGGACGTCCCTTGAGCCGCGTGCAGGTTGCTTGCCGAGCGGGACGGCGAGTGCATCATCATCG
CAATTCCGTTGTCGTCGTACGCACGAACCGCGCCGGAAATCGACGACGCCTGCGTCAGAATGGATCCAGCACTGACTGAGCGAACGAGCCGAGGTTTCCC
CTTCGCCCCGTCCAGGGGCGCAGACACCACGCTGGTGAGCCGCGAGTTCCGGAGTAACCTGTACTCCTGTTCCTGCTGCTGCTTCTGTTTCTGCTTCTGT
TTCTCCTCGTTTTCTCGGATGGACCTGGAGTCGTTGGCGGCCTGCTGGATCACCGTCGAGTCTGTTGAGAAGCGCTTCATGGCGTTCATGCCGCTCGCAA
TGTGCGGACTCTCCATGCGCGAGAAGCTGGCGCGGTCCATGCTGAGGTCGTCCAGCATGGGCGAGCTCTCCGAGGTGCGCGCCTGCAGCTGCGTGCGGAA
GGATCCGCCTTCCGACCGGCGATTGAACGACCCGTTCATCGTGGCGCGAGTCGACGACCTGGCGCGCTGCGAGATGCAGCCGTTGATGCACGAGATCCAG
GCGTCCATGCTCTCCTTGCCCTGCTCGGCGACGAGCGTGAGCTTGCGGCCCTCCGTCTCGATGGTGAACCTGTGCGGGAAGTCGTCCTTGGGCGTGGGCT
GCACGCGCGTGTTCTCGTCGATAGTGACCTCTCCGAGCTTGGCCAGCTCCTCCGCCGACGTGTAGTAGCAGAGCACGGGGCGGTCCCGCCGCAGGATGAA
GAAGCGGCGGCGCCACGACTTCCAGAAGGAGCCCTGCTTGACCAGGTAGCCGCTCGTGATGATGTCGGCGTCCGAGAACTGCTCCACGTCGTTGCCGCTC
ATGTGCACCGTCTTCTTCTGGTACGCGCGCTTGCGCAGCCTGGCCATGGCCTTGCTGCCGTCGTGCGCGTGGTAGAACTGGTCCTCGAAGCGGCCGCTCT
CCGACAC