Description :
From Genome Similarity Track
Location :
Scaffold_15:109847- 113148
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05155PREDICTED: uncharacterized protein LOC100825843
Sappa_CBS223.65SPRG_05156Hypothetical protein
Sappa_CBS223.65SPRG_05157predicted protein
Sappa_CBS223.65SPRG_05158het-eN

Sequence
3301 bases(100 bases per row)
CTAGAGATCGTCACGCTATCCTGCGGGGAAAAAAACTGCATGATGAAAACGATCGCAGATGCGGCGACGTGATGTGGATATACATGTACGTGGGCTTCCA
GCGTCCTGGACCTGGTGCATCAAGCACGGCAGGTAGGTGCTGCGTAAATCATAGCCTCCAGTGATAACCTCCGAGGGCGGTCCAGAGTTTATTGCGTGGC
GAAGCTCAGGCGTATGAACTCGATCACGTTGCCTGACCGTCGTCGAAACAGCCGAGTCACGTCATCTGGCCGGCTTGTGCGACGTACACTTTTTTGAAGT
GCGCGCGTGCTATGTTCTGCGTCTGTCCGGATAATAATGTGTATCCGGAGTAGACCGTGGCCTCTGATTATCCGTACGACTCTCCGGATACCGTTGGTGT
TATTGCTATTGCTGGTCGAGGTCTTGTCCAAGAAGCCAAGATGATGATGATGCACCGCCAGGCCGTCCGCGCCTTCTCCAGTAGGCTCCATAAGCGCTGC
GTGCAGTGGACTCATGCGTATGCTAGCCGCTCGTGGCGCCGCGCCCCGCGTGTTTCCGCAGTTTTCCAGCTACGGCAGCGACGCCCTCTTCCAAGTATGA
CACTTGATTTCGCGTGCCGATCTTGGTCGTCATGCTGGATGCGTAGGTGGCGCCGCTCGCCCCCGTGTACACGCACACGGGCAAGTACCTCAAGCTCAAG
CGTGGGGTATGCTCTGCGGTCCATGCAGCATCGGCTCATGCGCGCGTAGGGCTCGCTCATGCTGAGCTGGTGCAAGGCGACGCAGCAAGGCTACAACTAC
CAGGACAAGCTCGTTCACCCTTACGCCCTAAGCACACGAAGGCTCATCTGCCTCTTGTAGCTGTTCTCGGTCTCGCCCCGCGAGATTGGTGCTATTCTCA
ACACGCTTGACTCGAAGCAAAAGGTCGATCGGACGGCTCGAGTATCGGCCAATGGACTGTATAATAGATCACGCTCGTGCACTCGCCCAACATGAATGAC
CCGCAGGTACGACGAGCTAGACACCTTATCGCCATTGACGTGGCGCAGGCGAACGAGGGCTTGCGCAAGTCCTTCTCGATCGAGTACCAGCCCGAGCAGC
ACAAGACGGTCTTCGCCTTCACGAGCGACCAAGCGCGCACGGCTGTAGCCCTTGATGCCGGCGAGACGCGCGTGCTCAAGGTATACCACTGACCACTGAC
TAAAGGTTGCTCATGCTGGGACAACACAGGAGCTGCTCCAGTATTCGCTCCCGTACCTCTACGGCTTCCACTCGGTGCTGGCGGCGGAGCCGTACGTCGT
TCCTCTTGCGGTAGAGAAGTTGACGCGTCGCGTGCTAGGACGATCGAGTACGAAGGTGGCGCGATGCCTGCGTCGTCGGGCCCGAGTGCGCCCCGTGCCA
ACCGCGGCCCGCCGACCGCCGGCGAGTGGCCGTTCTAGAACCTCGGCTCCTACCACGATAACACACAGAAATGGTTCGCATGGTGTCTTCTTTGGTGCCC
TATAGTCTATTCACGTTGCGTATTCGATGTCTATGCACGAACGACGGACTCCTCGGGCGCCGCAGGGCTCGGCGTGGCGAGGCCAAACTTGGCAATCTCG
ACCTCGTTGCGCGCGAACCCTTGCAGCCGCGCCTGGCCCATCTGGCACACGACAGCAAAGCCACCTAGCGCACCGGCGAATGCAGCGCCGAAGGCTGTGC
GCTTACGGAAGAGCGCCGAGACGCTCTTGTCGGGCACCTTGAGGCCCGCAATGTACATGCTGGCGACGATAAAGGCAAAGCTGAGTCCATCGTCGGGCCG
CGTGGCCTGGAGGATCTTCTGAAGTGGCGGGTTAGCGTCAATGACTGGGAACTGCGGGAGGCGCGGGTCCACAAACGGCTTGGGCGTCTTGCGCTCGCCG
CTGAAGAGGTCGCTCAGCATTGTGGTCGTCAGATTATTCGGCGTCTGCCGCCTCTATAAGTTAAAATCGGCAACCTCGATGAGAATGCCGAAACGAAGTC
TGCACGCTTCCTATCCGCGGCCCAGGCACGGCACTGGACTATGGCTCGGCAGTCCTCACCTTGCGGGTACACCGCGAAGCTTAAATACTACTACGTAGTA
CTACATCTATTGTAGACATACGAGCGACTCGTGTCGATGGACGACCGAGGCAAAGCTCAGAGGCAATGGCATAGGGATGCCGAAATTAGGCCAGTAAATA
TGGCATGCCACGCAAGGTGGTTCGAAGTATGTATTGTGACAGGGTATGTATTATGAGGAGTTTTATTCCAGCCACTCTTTTGGCGCAGTCCAGAGCTTCT
ACCCCACGACGACCATGTCCTCGGCGCCCATCGACCCCCGCGCTCCGCGCTTCCCCGTCACGATGAAGTACCCGAACTTTGGCGATACGACCGACAACTT
CAACTTCTCGGACTACGTCACGATCTCGGCTGCGTCGGCCATCTCGTGCGGCGCCGGCTACGCGCTCGGCAAGCCCGTGCGCGGCCCGTCCATGGTCGTC
ACGGGCGTCCTCGGCACGATCGCCGGCTTCCTGTACGCTTTCCAGAACTCGTCGCAGCGCCTCCAGGGCTTCCAGAAGAACTAAGCGGTATGTCTGCGTA
ACTACTATACATACACCAGTGCCAAGACCATGTCTCTCGTTCGCCGGCTTATGCCACGCACGCGCGCAGGAAGTCGATCACAAGCGTATAGCGCGGGTCG
TCGACGGTCTGCGGCTTGCAAATGTCCATGTGATCCGTGTTTGACAAGAGGTGAAACGCATCCAGCGGTCCGCCCGGGTTGGCCGAGTCTGGCAAGACGA
CCATCGACCGGACGCCTAGCGCTAGCGGCGCGGGCTGGCCCTCGCCCAAGCTCAGTGACGGGATCTGGAGCGCTTGGTACGCCTTGTGCAGCGCGAGCAA
GTGGGGCGCGTTCGCCGAGAGATCCTTCGTCGCCGGGTGGGCTTGAATGAGCGCGCGGATCGCCCGCGCGTTGACATTGGAGCTCACGTTGGCGCCAAAG
TGGGGCACCGCCATGAAGACAACGCCTGCGGTGCGCGACGCAAGCGACCGCTCCTGCGCCTTGGCCAGCACGAGCATCTCCTTGACGAGTAGCCCGCCCA
TCGAATGCGTCACAAAAATCACGGGCGGCCCGTTGGCGCGACCGATGCGCGCCGCCTCGAGCGCCTCGAGCATGATCTACACCATGACAAACATGAACGA
CTACGCTCTTGCTATCGCCAAAGAGGCGTACCTGTGCACGCTGCGGCAGCGTCAGCGACGGCCACGGAGAGCTCCACGTGACCATGCCAGCCTCGTAGCC
C