Description :
From Genome Similarity Track
Location :
Scaffold_57:109833- 111646
Transcript NameFunction/comments
Phyca_LT153410868Hypothetical protein
Phyca_LT153438563ankyrin repeat

Sequence
1813 bases(100 bases per row)
ctaagtactaggaatcgaggagcgttggtggagacgttggatttcgtggccagagcgtccgagttcgtgtgtgctcgacgtgttcaagtgtttgtagcca
agttgttgcacgctgtggcggagagcgacgtgggcgatttcacgagtttcgagaaccagttcgaggaactggtgacggaaatgcaaggcgcagtcagttt
tatccgcttcttcttgcagacgagagcgtcgagacggaagaacaacaacacgtgaatgggtttgttggttagtattggtagttttggatagtaatccaga
tatgggtctgtttatttcagcagccattcagaaaaattgcgatcgctgatttgggggataataaactggaatgcagatgagaatttaaaatggctattgt
cacggcgtttcattttaaaggttcctagcaccaccacctcttggtattgtcagattcaccctgagactcaacccattcaacgacgtgttgctgtccatat
atcctcgccatcttcactgtaaaatcacttaagctctcgtactgaggagagtacgaatcatgtctgctcagaatgcaaaagtgacaaaaactttggcaat
gatagcgtcgcttatcccgttcatgatgaaataaccacttcaccacatctaaatgaccattgcacgtcgcaaactcgattgcgtgtgttgagtacccctc
cgttctgttttcatacagccacattaccacatctaaacgacccaatcccgcccatttgtcgattgcggtcgttgagcacaacgtcacactatcttgattt
tcatgcagccactttaccatttcgaaatcgttcacgtcatccattgtgtaaggtaagcacccttcgttagtgttctcgtgtagccatttcaccacatcta
gattaccattctgcgctgcataggtcattgctttttctgtgcatctctctgttcggttgttgtgcagccacttcattacatccaagtggccattacccgc
tgccgcatccattgcgccagtgctacatccctctgttcggttatcgtgcagccacttgaccacatctaaatgaccccgtgacgctgccgcatccattgcg
ttcgtactacgtatatcttggtagtgcgtgtgcagccacttgactatcggcaaatggccgtatgccgccgctgagtccagcactttaccccagtcacatc
gatcggcgttgaactcggacagccactgcaagatatctaagtgtccccgttcggcggcaaattccgccattctgtcctgataagcatcggttcccctagc
agcgacgagttttatcagtcttaaggagccacgataacaggctcctctactggaacccagtcgtaggaactcgttaatatgtttattgatgtgcgagagc
tcacgagatagcagacactcacgacaaaccacttggacagaggttaatatcgggaactcgtccatcgaggatggcattgttctcccagacgaaaaatacg
cgaatgacttgtgactttgactttgtttatgaatgaacgaaaacgaccccgtcatggtttgactattagtcaatctcccaccctctgaggcactagcagc
acttaaacttcgagataaatttcaataactatttctccggagttttttcatccattttagcaccgatcgttccaggctattctttttactgaacacgttc
atccacattcctcataacgagttcttaagggtacagggacatagtattcatattcagatcgtgttgtacgaagattgatccggcagatgagacggattat
gactcgaattacg