Description :
From Genome Similarity Track
Location :
contig_61:109787- 111653
Sequence
1866 bases(100 bases per row)
GACGCACTTTACGGATGCCCAGCTCCCAATCTCGAGCTGTGTCATTGGCCAGCACCACTGTGTAAAATCACTGTATTATCTTCGTCACCTTCACGGACCA
TGAGTACCACCTCCACCAAGTCTGTGAGAACCGCCACCACCGTCAGTCTCCTCATTGCTGAGGTTGGAAAAAGTCTCGCCAAGTTCGCACGCAAGCACCA
TTACCGCCGAGATCCGCCTCGCTGTACCCAAGAGCGGTGTCGCCGTCGAGAACCGTGTCATCACAGTTTGGGGTCGTGCTGTCGCCACTGTCGCGTGCGT
AAGCGGCACCAAGACCTGCCTCGACGCCGAGATGGGGCACAATTCCACTGTCTAGTGCAAACGCAGCAAGTTCGTGAGCGGAGTTGCTGCCACCCAGACC
GAATGCAGCAAGACGTTGAGGTCTGCTGGTGTCGCGACTTAGATCAGCACCACCACCGCGTTCGTGTATGACAGAATCACCACCGGATGCGCAAGCAGTT
TGGCTATCACCAGTTGGTCGCCGTACGACGCCATGTCGTGATTCATGAGTGGCTTTCAACTTGGCGAGGTTGGATCGGCGCCGAACGTTTCCTTTATCCG
TAAAGAGCCCGTTAGGATAATAGAACTGATGGAACTTATCCCAACAGGTTGATGTCGTCGACGGACACATCCATGGCTTGGCGGAACATCGTGCACGACA
CGGCACAAACACACACCGTGTCGGAGGCAATATGTTGTCACCTCTGTCGGATATCGTCTCTCCCATCTACACACGATGCATCGGCGACGCTTTCTGCTTT
TCTCGGCATGAATTTGCCTAGATGACACTGAAGCGCACGCAGTTATTGCAGTGACAGCAGCATTTCCTCCACACTGCTGAGACGAAGGCGTGGAAACCTG
CTCTGCAGCTTCGTCGTCAAGCATTTCTCCATTGTATAACATGCGGCCGTCGCTCGGTGCGTTCCTCCATTGCCCATTCAAAAGTTCTCCTATTAGCTCC
ATTACAAAGCTTCTATGTGGATCGCGATTCGTCGGTTCTGACTTCACCAACCGCCGTGCAAGATACACATTAGCTCTCGCCAGATCGATCAGAGCAAGGG
CCAGCTTTTTGTGCCAACGTTTATATGAATGGCCATCCGCATAGAAAATCGTCCTCGAATTTCGTCCAGCCTGTCAACACCTTGCATGTTGGCGTTGTAT
TGGGCGACGCACGCTGGCGCTGGAAATGACAATTTTTCACTGCTGATCATGCGGGTTACAGTAGTAATATTGGACGCGTCAGCATTAGACAGCATGTTTA
CGACATTACCGTCACACCACGACGCTGCCAGCATGCTGTGGTCATGTGAGACCGCCTGGCGATAGTCTCCACGAACGCAGTCGTTTTCAGGCAAAATACT
GTGGACAGGGTAGTGTTTGCTAGTTGAGCGGACAGTTCCTCGTCCATAGAGACCCTTCAGGCGAAGACTCTGCAGCAGCTGAACCGACGTGTAGTAATTA
TCCATGTTGACAATACGATTCGTACCAAACAGCGGCCTCGTCACCTCCAGCACATGCTGTCGGATTTTTGCTTTTTCCAATTTCTTCAGCTGATCACTCA
TACTTTGTGCTTCCGAATGATCGACTACACCATTCAGTCGATTCAACACGTCACTTCGCTTGCAATGAAGTTTGTAGTTTAACGCGATCCACGTCGTAGA
ACAGCACACCATATAAAACTTGAAATGGTACTTCCCTGTTGGTTTCATGGATTGTACATGATCATGTGACGACCTTGGCGAGAGCGGCAGGCGACGCTGG
CTTCATCTAGCGCAACATTTTGCCCTACGTGAATATACTGACCTCCAGTAATCTTCAGCAAGTTCA