Description :
From Genome Similarity Track
Location :
Scaffold_44:109774- 112051
Transcript NameFunction/comments
Hyaar_Emoy2805935unnamed protein product
Hyaar_Emoy2805936hypothetical protein

Sequence
2277 bases(100 bases per row)
GTTGTCCGGATAGCTCGTATAACCCACCGCATTGGCGCCGCGGAGAAGCATCTGAAACGGAATGTCGGGCACGGCCTCGCGCAGAATGGCTAGACGGTCC
CACGGATCCTCACGCAAGAAGCGCATTGACACATCGAATGTCGCGCCACCCCACATCTCGAGTGAGAAAGCATCTCGCATTGCAATGGAAGTAGCAGGCG
CGATTGCAAGCATGTCGCGCGTACGCATACGCGTAGCAAGAAGCGACTGATGAGCATCGCGCCACGTAGTGTCAGTCAGCAACAGACCCTTCTTCGCACG
AACAGCCTTGGCGAACGCCTCCGGTCCCTGCTCGACGTAGATCTGGCGCAGCGACTTCTCCTTTGAAGTAGGCGGGACAGACAGCGTTGGAATAAGCGGG
TCAACCTTGGACGGAGCAGGACCGATGGCGCCCAGTTCCTTTTCAGGACCGTTTACAATCGTGTTGCCAATGTACTTAAGCATCTTTTGGCCACGGTTCG
TGGACGTTGATGGTAGCAGCAAGTCTGGGTTCTCGGCAATGAAGCTTGTGTCGATAACGCCCTTGATGAAATCCGGATGGTTCAGCACATTAGTAAGGAA
GCTTTTGTTAGTGGTCACACCACGGACACGGAACTCAGACAGCGCGCGCTTCAGCTTCTGCGCACAGTCGCCTCGGTCCAGCGCACGTGCAGTCACCTTG
ACAAGCAGTGAATCATAGTGAGGAGTAATGTGTGCGCCAACGAATCCCGGACCGTCGTCGAGACGGATGCCCATGCCACCAGGGCTACGGAACACTTCAA
TAACACCCGAGTCAGGCTGGAAACCAGTACTGGGGTTCTCCGTGGTCACACGGCATTGCATTGCATGGCCGCGCGGCTTAATCATGTCCTGGCTCAGACC
CAAGTCTTTGAAAGTCTCGCCACCAGCGATGCGGATCTGGCTCTGCACCAAGTCAATGCCCGTGATCTCCTCGGTGATCGTGTGTTCGACCTGGATACGT
GGATTCACTTCAATAAAGTAGTGACGACCTTGCTGGTCCACCAGAAACTCCACCGTTCCTGCATTCAAGTACTTGGCCGCACTCGTAAGACGCACCGCGT
CGTCAATCATCGCCTTTTCCGTCACCGGATCCAGTCCAACAGCTGGAGCTGTCTCCAGTACCTTTTGGTGCCGACGCTGCACGCTGCAATCACGGTGGAA
CAAGTGCACCACATTACCCTGTCCGTCCCCCAAGATCTGCACCTCAATATGTCGTGGTCGGTCCACGTAGCGTTCAATAAAGACCGTGCCATCTCCAAAA
GCTGCCAATGCTTCCGAGCTTGCACGCTCAAAGTTTTCGTCCAATTCTGCCGCTGACGTGACAACGCGCATCCCACGTCCGCCTCCTCCCATACTAGCTT
TAATAATCACCGGGTACCCCACCCCCGAGTCAATAAATGCCCGAGCTTGCTCGAGCGAGCGAACCGGTCCATCTGTTCCAGGTACTACAGGTACATTTTG
TTCCTTTGCAATTTCCCGTGCTGCTGTCTTGTCCCCAAACCGCTGGAGGTTCTCCGGCGTTGGACCGACAAATTTAATGCCGTTCCGGGCACATTCTTGA
GCAAACCCGACGTTTTCGCTGAGAAACCCGTACCCGGGATGAATAGCTTCAATGCCGTTTTCTTTGGCAATTGCAATGATACTGTCAATGTCCAGATAGG
CCCCAACGGGCGTCTTGCCTTCGCCAACGAGGAAACTCTCGTCGGCCTTGTACCGGTGCTGGGTGAACCGATCTTCTTTGGAAAAGATTCCGACCGTCCG
GATCCCTAATTCGTTGCCAGCACGCATGATCCGCGTGGCAATCTCCCCCCGGTTCGCAGCCATGAGCTTCTTGATCGTGCTGGCGTGGCGTGTTGGTGGC
TGCGCGTGCGTGAAAGAAGGGGCGATGGCGCGCGCGCGACGGCTGACGAGCGAGCGGAACATGAGTGGATACGCTCCGGATACGGACGGATATGATCCGG
ATACGAGGGCTGAGGGTCTGGGTGTGAATTCGCAAATGAATGAACTGAACGGGGAGGGAGGGGGGAGCAAATCGACATGTGAGCAGACAGACGGACAGAT
AGACAGACGGGCGAGGAGGGAGAAAGATAGGGAGGTGCGACCTTTGGTTGAGTATACAAATGTCAAGGTAGTTTTTTGAATTGGGAGGGGAAAACCAGAT
GGGGCGGTTTGGACAAACGCGGACCGTGGATCCAACGAGACGCTGTCACGCGTTTTTTTGCTTCACGAGGGATCTTT