Description :
From Genome Similarity Track
Location :
Scaffold_152:10976- 14797
Sequence
3821 bases(100 bases per row)
AAGGGAAAAGAGGGAATAATCTCCTTTTGTGGTTCCGGGATGTAGAAATGGCCATGAACTCAGCTATACTCCGATCGGTAGTAACAGCGAGTTGAGCTGG
CAATCTCAAAATTAAGTGGTCGAGCCAGAGAGTGGGTTCTTAAGTGTAGCACGTCTATAGACGAATCCTTCTCCACATGGGATTTGCAAAGACAGCAATT
ATCTCGGGTGTTTGCTCCGCATAATCAGGCATATCACGTGCGCTTCTTATCTGCCCACCAGATCAAGAAAGAACCATCGAACTATGTCAAAGATCTGAGA
GCTCTAATTATTGCCATGTAGCTTTATCCCTTACCAGATATGGTTCTGGTAACCATCTTTATGGAGGGTCGCCGTACTGGCGTAGCTCGAACGGAAGTAT
TTCGACTCTACCCCATCTCCTTCGAGACAGCTGTAGATTTCGCGTTGAACGCTTAGTTTAACTTTAAAGCAGTCCGTTTTGGCACCCATGGGTATAACCC
ATACTTGGCCAACTCATTTAGTTCACCCAATAGGTCGGAGCCTCTAATCTCCAGTCTCGCCGAGACGGACGAAGAAGCAGAGCTTCGAGCTGTAGAACAA
AATCGTTATACTCGGCGATGTTACACATGCGGAAGCACAAGAAACCTGCGTCTTAATTGTCCTTTATGTAAGGCCCGCCAGAAGTCTTCGAATCTGGATC
CCTTCTCTAAATAGAATTGTGGTGGGGCGCGTGAAAATTTAGACTCCCAGTAGGCGTGGGGCGCTCTGCTGAGGAAGAATTAGGTTGTGTTGAGCCTCTA
GGAGTTTTGAGCAGGACTTATCTCCAAAGGGTTCCTTACACTCTAATAGGTGATGGGAATACAACCCAGGCTTGTAAGTCGCGAATCCAGATGTGAGTGC
TGTGAGAAGTCCTGGTCGATTTTGATCGACTCCGGTGCATCCAGTAACCATGTGAGACGATGTTCCCACGAGGGAATTCGACTGTAGGATGAGGCGCTTC
AGGCGCAAAAGGGTGATACAACCCCCTTTCGCTCAGCGACAGGGACTTTAGTCACCGTAATCAAAGTTGCTGTGAACTTAGGCGTGAAGTTTTTTGACTT
TGACAGTATCGATCGCTGTTTAGTCCTCGAGATATGATCTCATTCTTGGTATGGCCTGACTTGAGCGCCACGAACCTAGGATTGATTGGAGATCAAAAAC
ATTAGGCGCAACGCGCACTGCACCTAGCGGAGCTTTGGAGAGTCATGAACCCACCTCCGCTAGTAATCAGAAGCGCTATTGGCGCAATCCACTGGCTGAT
TCTGTAAGTGTGCTGGAAATTGAAATGTCGGAACTAGTTGCTTCTGATCATGCCAAAGACACCAGTATCGAGCTGAGGTCGTTATTTGATAGTGAAAAGG
CACGTACTTCTTTGAGTGATATTCGTTGCAAGAACGACTCACTGGACGCTACAAGCATTGTTGACCAAGCGTCACGTCATCGAGGGTTGGACCCATCAGA
ATAGCGTAGAGTTGCACATATGTACCTACTGAGTGACTTTGGCTGTGATAGAGACGCGTTGAATGTCAATGTTGACGTTGCTGGTGAAATACCAAGGCAT
CCCAAGCCCGGCCCAGCGGATGCGCGTGAAGTGGAACGTAATCCATGTGATTGAAGACGTCACGTCAAAATACTTGTTATCAGATGCCGGTAGTGACAAC
AGCTCTAGCTTAGAGCAAATTACGTTTGACAATGATATCGATCAGAAAGATACGAATCACATAGCGCTGTGTCACAAATTGATGATTACTACCAGCTATA
TACACTCATCAACGGAGTAACTGGTGTCTGTGAAGGTACGTCTAGCCTTGAGGATATACCCTCGTTAGGTGCTCTTCTTGAACTCGAAGAATTGTCAGTC
GATGAGTTTGGTCACTCACTAAAGAATGAAGATCTTTCAGAGGTTGTGGTCATTCGACCCGACATCATAGAGTTGAACTCTTCTTCACTTTTGGATGAAG
TCGTTCTGGAAGACACAAAAGCGGTACTCAGTGCGCTTAGTGGGTCATCAATGTTGAAAAACCTTTATGATCCTTTTTATCCTTTATTCAAGGAATTTCA
AGATGTGGTGTGCCGCGACCCACCCTCTGTTCTACCTCCAGATGTAGGTGTCCGTCATGAAATTGACTTAGTTCCTGGTATTAAATGCTGTATCACACTA
CAGTTGCCGTTGCCTATAGAGCAATGTGATGCCATTGATGACTTCTTCCGTGCCAAACACGAGGCAGCAATGGTACGTGAAGATAAATCTCCACATTCGA
CACCGAAATTTTGTGTCAAAAGCCGAACAGCAAGTGGCGTATTGTGCATGCTTATACCAAGCTTAATGCGGTTACTATTCCGGAACAGACCCATTTATCG
AAAGAATATTCTTTAAAACAATATAGTTGGTTGTAATATGTGTAGTGCACTCGACTTAGTCGATGTCTATAACCAATTGCTCATGCGATCGCGTGATATT
CCGCTCAGCGGTAAGCACTCCTAGTGGTATGCTCTGGATATGGCTGGTGATGCCGCAAGGGCTGTCGAATGCGCTGGCTAAGTTTAATCGTCTGGTGACG
CAACTTTCCGCCCCCATCGGGATTATGCACAGACATACTTTGATGAAATTTTTGTCCATAGTTGTGCCGAACAAGGTCGTTTGGATGTTGACAATCACGT
CGGGCCCCGTGCGAGCCGTGCTCGACTGTATGCGCACGAATAAACTGTACGCCAGTGTATCTAATTGCATCTTTGTGCAGAGGAGATTCTTTTTATAGGA
TATTCATCGGTAAGCGCGGTCTCAGAGCGGATACCGCTAAGGTCAAGGCTATAGTTGAAGAAACAGTTCCTAATAATCAAAAGGACTTACGTAAGTGGCT
TGGGCTTGCCAATTACTTACACAAATATAGCGATAATTACGCTGATCTGGCTCGGCCATTAGCTAATTTCCTTGAGAAGCACGCATATTGGCGCTGGGAT
AGCATCCATTTGGACGCATTTCGAGTAGTCAAGGTGAGTCTCCTCCATGCCCTCATTTTGGCGTTACCAAATTCTGAGTGCATTCTGTGACGCATCCGAC
TTTGCCTTAGGCAGCGCCCTGTTGCCGAAGGCCGCGAGCTTGTTGTAGAATTGAAATCTCGTCAGCTGAAAGCTGCTGAAAAGAACTATCCAGTTCATAA
AAAAGTGTTACTTGCCATGAAGTATGCTCTCTTCAATTTAGAGCTCATTTACTTGGCTTCAAGCCTTTCGTCGTCTACACGGATCATCCGTCATCACGCA
CGCGACACAGTCGCCTCACCTATCTCAAAGAAATGCTCGTTGTATATCCTTCTTTACAGAATATAACTTCGAGGTGAAGTATAAACCGGGCAAACAGAAT
GTGCTAGCATATGAACTCCTTCGCCGACCTGACAATGAGATCGCTCATGTTACGAATCTGTCGTCGCCTATTGAGGATTTAATCCGTGTGGCCTATTCAC
AAGATTCTCAATGTGTGGCATTGTTCTATGCACTTGGAAGTGGCGAGTACAAAGACTCGGACAGCTCTTTGTCGGCACTGTTACGTGCCAGCCTTCATCG
ATGTTCCATCGATGGTGGCCTATTGTGTATTGAAAGTATCGAATCCTCTTTAAGGTACATGATACTGCTCTCAGTGGGCATTTGGGCCGCGAAAGATTTA
CGGCTCTGTGAGTCAACACTATTGTCGGCCTAAGCATTAGAAATGGGTAAGCACGTATGTGCGTACATGCAAAACGTGCCAGAGGGCTAAACCCTCGGCA
CTTTCGACTGCGCTCGCTAGT