Description :
From Genome Similarity Track
Location :
scaffold_7:1097471- 1099546
Transcript NameFunction/comments
Plaha_PHALS_03666cullin c
Plaha_PHALS_03667hypothetical protein L915_00224

Sequence
2075 bases(100 bases per row)
AATTGATAAAGAATCAAGCTAAAGCATTGGTTGAGCTGGAACACTCAGGATGCATCGCGCTCTTTCGTGACAATAAAACTCAGGCATTGCGTAGAATGTA
CTCGCTATTTCGACGTGTACCAAGTACATTACCGGAGATTAGTAATGCTGTGTTCCAATATATTAAGTCGCAAGGAGACGAGTATGTCAAAACACAATTG
CAGGCAGAAACGGCATTGGATGCGTCTCAGTTTGTGGAAAAGCTTTTGGCTTTGCGTGAAAAGTTTGTAAGTTTTTTGTCGGAGAGTTTCTTTGATGACT
CGCAATTTCGTCTTTCCATAAAGCAAGGATTTGAAGCATTTATGAATACGAATACAATCTGTGCTGGATACCTGGCGCATTACCTAGATGAATTGTTGCG
CTCGAAGACTCGTTTCGAAGAGGAGATGGACACTCGCGTGACGCATGTCATTGCTCTTTTTCGATATCTGCAGGATAAGGATGTCTTTGAGGAATTTTAT
AAGGTTCTACTCGCTAAGCGCCTACTAAATAGTCGTGGCACATCGGATGAGGCAGAAAAACTTGTAATTTCAAAACTCAAGGCAGAATGTGGTTATCAAT
TCACGTCGAAGCTCGAAGGCATGTTTAAGGATATGAGTATTTCTAAGGACCTCATGGAGTTGTATaaaaagtcaggaaacgacaCTCGAGGTTCCGGTTT
TGATATTGATTCCTCAATGGCACCAATGTTATTGTCAGTTCATGTGCTCACAAGTGGTTTTTGGCCCACAGAGATGGCTTCTGTGTGTGCACTACCATTG
GAATTTGTTCAGATGACTCAAACCTTCGAGGCGTTTTATTATGCCCGGCATAATGGTCGTAAATTGACATGGATGACTAACATGGGTACAGTAGATGTAC
GAGCTACGTTTATGGCTAATGTAGAAGATGGTGAACGTCGCCATGAGCTAAATGTGTCAACGTATCAAGCTGTTATCTTATTGCTTTTCAATCAACGTTC
TGAGTGGCGCTTTAAAGAGCTATTGGAGCTTACACGCATTGAGGTGAAGGATCTGAAGCGGCATTTGATTTCCTTGTGCACACCCAAGTACAAAATACTA
AACAAAAGTTCAAAAGGGAAGCGTATTGATGAAGAATTCGACACATTTACAGTGAATGACGCTTACAAATCGAAGCTACGTCGTGTTCGAATACCCCTTG
TATCTCAGAAGGAGACTTCGTTGTTGCCAGCTACGTCCTCAGGTATAAATCACTCCGCTGATGCGTTGCCACCTACAGTTGCTGAGGATCGCAAGCATCT
TGTTGAAGCTGCAATTGTTCGAATTATGAAGACACGAAAACAAATGCAGCATAATCAACTCATTGCCGAAGTCACACGTCAAATGGCTGGTCGCTTTACG
CCTCCTCCTCAACTTATCAAGCTGCGTATTGAGAGTTTAATTGAACGCGAATATATTCAGCGCAGTATCACAGATCGACGGCTGTACAGCTATTTAGCTT
GAGAAGTACCGAACAACAGAAAAAAGTCAACGTTACGTCACAACTTACAAATTCAGAAACGCTCTATTATCAATTCTTGTTTAAATTTTAGTCAAATATT
AGAGACTTGAATGTTTTTGCGAAAGTATCACTTTATCGTAAGTAGTATCGTAATATTATCGGTTTTGCGTACAACGCATAATCATGACTGAGTCGGAGTT
GTTGGGGCTCTCGGGGCTTCGGTCCGTTGCCGTACAATCCACTCATATTCACCATGTGCAACATCTAAAGCTCAGTCCCTTTCCATCCAAGTCTTGTACC
TCGAAGCCAAATCTGCGATTACGAATGCAACTGCAGCGTCTCTGGCGAGCGAACGCGTGGCTCATTTTGACACTATGCTTTACGTGTTTTCTGGCTACTA
CAACTGCTGCTACCTTGACGAACAAATCACAAGGCGGAACAACAGCTTCAAGCAATCTGTACATTGTTTTAGTGAGCATTCCCGTGCTAGATAAGGTGCT
GCCGCTCAAGCATTTAGCTGAAGCACTACTGTCTCGTGGAGTTCGTGTGGGCTTCGCACTGCCAGAGAATTGTCG