Description :
From Genome Similarity Track
Location :
scaffold_370:10974- 12651
Transcript NameFunction/comments
g7744.t1 eukaryotic translation initiation factor 3 subunit, putative

Sequence
1677 bases(100 bases per row)
GCCAGGATCGGGTCGGTCGGGGACCAGAAGAAGTCGTGCACGCCTTCAGCACGCAGCGACTTCTTCTCGAGCAGCTTCATGGACGGGAGCTCGTAGATGC
TAATGACGTCCTTGCCGCGACGGGCCACGTACTTGTCGTCAGCGCTCCACTTGAACGGAGTCATGAGACCTTGCACCACCTCGCCATTCGCACCCGGCTT
TCCAGCAGGGAAAGCACGGAGCATCTTGCTTGTCTTGACGTCCCAGATGATAATAGCCGACTCCTGGTCCGTCTCGCTCACCGTGATGAGGTAGTTCTCG
TTGGGCGAGAACACGGCCAGCTTGACGTTCTTGTGGGCAAAGCGACCCACCTTCTCGTACTTGTCACCGCCCCAGAGAGCAATGCCTTGCGGGTGGAAAG
TAGCAAGGTACGTTCCGTGCGGCGACCACAGCACGTACTGCGAGCACCACTGCTTGCCGTTCGTCTTCTCACGGTCGCCAGCGTAGTCGAGCTCGATCTC
GCCCTTGTCACTCCAGAAGATCTCCGTCTCGGAGCCGTGACGGAGCACGAACATGTCGCGACGAGCAGGGTCCGTAAGCCACGTCTTGAGGTTCTTGGGC
TCGACGAACTTCTCCACCTTAGGGGCCACAAACTCGGCCGGCGTCTTCTGGTAACGCTCGATGTCCTCGTACTTGTTCACGAGCATCGTGTGGCGCTTGT
CCAGAGCGAAATTGTTAATGGTGCGCACAGCGTCATTGGCCTGCGCTTCCTGCTCGTACTCAACGAAGGCGAAACCGGTCGTCTTTCCATTGGCGCCGAA
GGGCATGTGGATGTCCACCACAGGGCCCACCTGACCGAAGATTTTCTTCACGACGTTCAACAGCTTGCCGTGCTTGGCTTCGTCCACGGCGGGCAAACCG
CCAACCACGACGGCCATACTGTAGTCATTGCAGAAGTCCGCCTCCTCGTGGGCCTTGGTCGTCACCTCATCCTCCACCTCCTCCTCGCTCAGGTAGTCAG
CGTAGTGCTCCGCCTCGCGCTTCAGGTGCGCCAGCTTCTGCTCGAACGTCGTAGGCGCCATCGTGCTACAGACTCCAGATCACAAGTGAGGGGAGCTGTT
CGTAGCCAGTCAGTCGAATACTAATTATCCGGACTTTGTCCGGATAATAAATCTAGATTGTATGTTTCCTATAGGTCAGTATAGGTTATCCTTTAAAATT
TGTTTGCTCTACATATTAGAAAAAATTTAGACCGTTACACCACGAAGCGACGTAGAGCTACGGGTGTCGGGGCACTGACTGTCCTCTTCTCGCTCCACGC
GTGTTCCGCGCTGCTCGTTCACGATGGTTGTTACTGCTCACAACATCACTTGAGCTCGGAAGAATACTCTCTCGTCCACGGCGGATGCCGCACCCGTGCC
ACCGTCGAAGGAGGAAAGCTCCCGTCGGCAAGGTCTCTTCATGTGCACTGCTGCTACTGTCGACGGCGCGATGGCAATGCGGCGTGGATGCCCTTTTGGA
CTTGCCATCCGAGTTGCATCAGCTCCAGCGACAAAACTCAGCGAGTGGGAGCAACGTAGAGGCTGCAGCCCCTCAGATCGTGTTGGCTAACGTTCCAGAG
CCGCTGTTCAAGCGACTCGATGAGAAATCGGTGAAATGGGATGCACTATCCGGATATCTGCAACGGGCGCTGTTGTG