Description :
From Genome Similarity Track
Location :
Scaffold_266:10974- 12639
Transcript NameFunction/comments
Phyta_totarag6429hypothetical protein

Sequence
1665 bases(100 bases per row)
agcaacGATAAATGCCAAGCACGGTGCTCCAAGAGATTTGGCAAGCTTCAGGGCGCAACGTGGTACAGGAAGCAGCGATATGTTTGATACAGGAGCTCAC
GTGTCTTCCGAGcatcaaggacgaggaggaaatgAACGTACGTtcatgatgaagatgatggaaaTGATGGCAAACTTTCAAGATGGGCGCGCCCTACAGC
GTGATGACGATCGCCAAGACCGTAGGGATACAAGTGAGTCTAGACGAGGTACGCCTGATCGCCAGGAACGAGTAACGCAACAGGCAACGTCAGCTTTGCC
GACAACTTTACCGCACGATGAAGATAAAGAAGAGGCCAAACGTCTCAAAGACGACCAAACTCGTATCGAGCGTGAATTGCTGGAGCAACGCGAGTACGAG
AAAAAGAAACAGACTCGAATGGAGGAAcaggagcgcgagctggCTGAACAGAACAGGGAGTACGAAGAAAAGCGTGCTCACATGCGTCAACAACGtattg
aagaggaagagagaaTTGAGGAGCAACGAAAGCGTAAGCaggcagaagaagaaacaagGTTGCAAGAGGAGTTATCTCGGCAGCTTGCCGCAGttcaagg
agcagcagagttacagcagaagctggcaGAGCAGCGCTTGGCTGAcgagcaacaacgacaacagGAAGAACAAGCCTACAAGGAACGACGGCTCGCCGAA
GAACGGAAGTTCAACGAAGAGATTGAAGCAAAGCGTCGTCAGCAACAACTTGAGGATGAAGTGGCAGCAAAACAAAGACAGGAACGAGAAgcggaggaag
agcgtcTGAGGCAAGAACGCAAAGCACACGTAGATCACGAGCGGATCCGGTTggagcaagaacaagcagcagctctccgagCAACTAAACAAAagcaaga
ggaggaagatcgtcagcgagaagagcaacTACGCCTTGCAGAGGAAGAGAGTAAGAGGAAGGAGGCTGAGGATGCAGAGCGAACCAGAACCGAAGCGGTA
CTAGAGGAAGAATCACGGCAGGAATCCGATGATGCCGAGTCCAACAGCAAGGATGCGAACGCTGACACAGTGAATGGTGAGACTGCTGTTACTATCCCCG
AGGACTCGAATGCAATCGAGAATTCTGGAGAAAATCTTCCGAGTGACAGTGAGGCGCCCATAAGTGAAGATGCAGtgtcaacagcagcagtgagcTCTGA
TAACGCTAACGATGATCAGGTCCTCGATGATACGGTAGGAGTAGGAAATATTCCAGCCGCCGTAACGGAGACTCCAGCAAAGACGccggaagaagaagag
caggaacgAGCGAAGGCTGCAGAGGAGGCTaagaagaaggaggatgaagatgccaTCGATGTGTATCGACAGCGAGTACTTGCGAGGAAAGCTGCGGAGA
AACAACGACAAATCGAGCTGGATGCGGAAAACGAACGAAAGGCaaaagaagaggaagaacgcCATCGACTTCATCTTTTGGGTGATGCTAGCGGATCTGA
TCATGAACTCGAGCTGTCGGGGGGGTCGTTCGCCGAATCCAGGTATGTGACTCAGTGTTGGACGCTGCTTGATATTTGAGCCTAACTTTTCATTTGTGAA
TTTTCATGACgcagtgctgccagcaacagcgactcGTTCTAGCATAGAAGAGAACCAGCAAGATT