Description :
From Genome Similarity Track
Location :
scaffold_717:10974- 12513
Transcript NameFunction/comments
g9973.t1 conserved hypothetical protein

Sequence
1539 bases(100 bases per row)
AAGTCAGACCTGCGGGGCTTCCACAATGAGAAAGCCCTCGCTGCAGTCGCTGCGCTTGGACTGCAACTCCAGTGCGTGACTGTTGTCGACGACCTTCTCG
GGTGAGACCGCGACGACGTGGCGTCGGACAACACGCGTCTCGCGAATGAACTCGCACAGCGAAATTTGCGCCAGGTCATCGGCCGAGAACTTCTTTTTCG
GGTTCTTCAACACCATGATCTTCGTGCCCAAGCGGCGGTTTGCTTCGGCTAGAAAACAGCGTTAGAAGGAGACTCAATGGAAATATGACAAACTAATGCG
ACGCACTCCGTGATCGCACGCCGTAAAACTGGCACACACTGTGAATAAGCAATCGATGGAAAGCCGAGTCCAGGAGCGGCAGTATCAACCGCACGTCCTT
CTCGTTTGCTTTCATCAGTTCGACCGGGTGTTTTAGCATTCGCAGAAGTGACGTGGCGACTTCCAGTTCTGACGGCACTTCTCGCCACTGCAGCAAGTTT
CAACAAGAGACCACTTAGTTGAACACTACACCTGCACGGTGCTGAGTCACCGTACCTGGATGAAGTGCAAGACGACGTATTCGACAGCTTCAATAAACGG
CGCAAACGAGTTGAATGAGCGCAGCATCAATGTCCGCGCCCGGCGATCGACACGAGTGAACATTTGCTCGGCATCTGCACAGCCCCCAACAACATTATTA
ATCGCCATCAACACAGAACTACACATCTCCACACTTTAACTCACCGTTCCATCCATCTTTACGGCGATTGCGGGGTGCATGGGATCGGTTATTCTCATGT
GCGCCTCCTCCCTTACGGAACTCCGTCTGCAGCTCTTCGTTTTGGGGCTCTGCCAGCTTCTGAAAGTTCGATCTGACATTTTAAATCGCCACGATTTCAG
TCCCGTTGCTTAATAAAAACAGCAGGGTCTCTGCACCCACCTCCACTCCACGTTGATGTCCATGTGCTCCATCAAGTCCTCCAGTCTAGTGGAAGCCGCT
CGGTTGCCGAAATGGTGGTCTGTCGCATCACAACATGAGAATCCATTCCAAAAAAAATCATGTTCTCCTCAGCTTCTATACCTTACCATTGAACCAGCGT
TGCTGTTTGCGCACGCCTACCGGCAGTTCATTGGGTTTGGACAGATACCCAGCCGATCGGATAGGGTGAATGTTGATAAGCCGCTTGCTACGCGCCAGAG
GCGAATCACTGCCGCGTTTCTGCGGCGTACGAGCGCGACCGGATCCGTTCCCATTGCTCCCGGAGCGCTCCACACCCGCGATCAGACTCTTTTTGGCGGT
GCCATCATCAGCAGGTGCCTCGGTACGTAGTGGGGCGATGGGGCCCTCGCCCCAGGCCATCTCAAGCTCCAGCTCGCTGCCGCATAGCGAACTGACTTCA
GAGTCGCTCACGTCTGATGCCTCAGTCGACAGCTTAATCGCGTGCTCCGTCATTAAGATAGAGCTGCTTGGGTGCTTATTCCGTGGTTGAGCTTCCTGGA
ATGAGCATACTGTAGGGAAGAATGAGACCAACACTCATG